Report of Systematic Zoology Lab Practicum, July, 2012


28S ribosomal RNA, partial sequence of Tetrastemma pseudocoronatum (Nemertea: Hoplonemertea)


Takuma Nakamura and Yuta Nakamura

Division of Biology, Department of Biological Sciences, School of Science, Hokkaido University, Sapporo 060-0810, Japan



Material and Methods
A ribon worm specimen was obtained intertidally among mussels in Oshoro Bay, Hokkaido, Japan, about 43°12′N, 140°51′E, on 21 May 2012 by Takuma Nakamura and Yuta Nakamura, photographed and identified by Hiroshi Kajihara as Tetrastemma candidum based on Kajihara (2002), and fixed in 99% EtOH. DNA was extracted from the entire animal using the silica method (Boom et al. 1990) with some modifications. Extracted DNA was dissolved in 30 µl of deionized water and has been preserved at –20°C.
      An about 1000-bp fragment of 28S ribosomal RNA gene (28S rRNA) was amplified by polymerase chain reaction (PCR) using LSU5 (5′-ACCCGCTGAAYTTAAGCA-3′) and LSU3 (5′-TCCTGAGGGAAACTTCGG-3′) (Littlewood. 1994). A hot start PCR was performed by a thermal cycler, iCycler (DNA Engine), in a 20-µl reaction volume containing 1 µl of template total DNA (approximately 10–100 ng) and 19 µl of premix made with 632-µl deionized water, 80-µl Ex Taq Buffer (TaKara Bio), 64-µl dNTP (each 25 mM), 8-µl each primer (each 10 µM), and 0.1-µl TaKara Ex Taq (5 U/µl,TaKara Bio). Thermal cycling condition comprised an initial denaturation at 95°C for 30 sec; 30 cycles of denaturation at 95°C for 30 sec, annealing at 45°C for 30 sec, and elongation at 72°C for 45°C and a final elongation at 72°C for 7 min.
      The PCR product was purified with the silica method (Boom et al. 1990). Both strands were sequenced with a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) following the manufacturer's protocol, using the same primer set as the initial PCR amplification, D2F (5′-CTTTGAAGAGAGAGTTC-3′) (Littlewood. 1994) and 28z (5′-CTTGGTCCGTGTTTCAAGAC-3′) (Hillis and Dixon. 1991). Sequencing was performed with ABI Prism 3730 DNA Analyzer (Applied Biosystems). Chromatogram and sequence data were operated with MEGA v.5 software (Tamura et al. 2007).

Results
Due to the low quality of the chromatgram data, only 1000 bases of the partial sequence of 28S rDNA were determined from our material (see Appendix).

Taxonomy
Phylum Nemertea
Class Enopla Schultze, 1851
Order Hoplonemertea Hubrecht, 1879
Suborder Monostilifera Brinkmann, 1917
Family Tetrastemmatidae Hubrecht, 1879
Genus Tetrastemma Ehrenberg, 1831
Tetrastemma pseudocoronatum Chernyshev, 1998
(Fig 1)



Fig. 1. Tetrastemma pseudocoronatum Chernyshev, 1998, ICHU22100036, photograph taken in life.





References

Boom, R., Sol, C. J. A., Salimans, M. M. M., Jansen, C. L., Wertheim-van Dillen, P. M. E., and van der Noordaa, J. 1990. Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology 28: 495–503.

Chernyshev, A. V. 1998. Nemerteans of the genus Tetrastemma (Enopla, Monostilifera) from the Far East seas of Russia. Zoologicheskyi Zhurnal 74: 7–18.

Hillis, D. M. and Dixon, M. T. 1991. Ribosomal DNA: molecular evolution and phylogenetics inference Quarterly Review of Biology 66: 411–453.

Littlewood. D. T. 1994. Molecular phylogenetics of cupped oysters based on patial 28S rRNA gene sequences Molecular Phylogenetics and Evolution 3: 221–229.

Tamura, K.,Dudley, J., Nei, M. and Kumar, S. 20011. MEGA5: Molecullar Evolutionary Genetics Analysis (MEGA) software version 5.0. Molecular Phylogenetics and Evolution 28: 2731–2739.




Appendix
Partial sequence of 28S rDNA (1000 bases) from ICHU22100036, identified as Tetrastemma pseudocoronatum Chernyshev, 1998.

TGATCGATGCCCAAGTCCTCCTGAACGGGGCTTTACCCATGGCGGGTGTCAGGCCTCTGGAGGCGTCGATCTCCGTCTCCTCGGTCTACCTTGGAGTCGGGTTGTTTGAGAATGCAGCCCAAAGCGGGTGGTAAACTCCATCTAAGGCTAAATACGTGCACGAGTCCGATAGCCAACAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAATAGTACGTGAACCTGTTTAGAGGTAAACGATAAGAGTCGTAAAGTGGTCCGGGAATATTCAACCGTTCGAGCGTTGGTTTTGGCGGGGTGGCCCATCGGATGCTCATATCATGTGTANCACCGGCCCCNTCATCATTGGCCTTCGTCGATCGTCGCACTTTTTTCCGGGGAGCATCNNCACCGATTCGYGCTGCTCGGTCATMATATTCGTCGKAAGAAGACTCYTCTCTCCTCGGGAGAATAATAATCGAYGATAACRTCGTCCTTTGGYGGATSAAGGAAKAACCGTMGCCCCTTCYTGTCCKCCSGAAAACACCGGCCCCTCTTCTTCCCCCCCCGTTGTCAACGAATGGGCTGGACTGTATACAGTGCTGTCCGACTGCGGCGCGCGTCGTGACTCAGGTGCGCTCCCGAGTGGTACAAAAGGTCGGTGGCGATTAGGTCGGCAATCTTATCGACCCGTCTTGAAACACGGACCAAGGAGTGTAGCATATATGCGAGTGGCAGGGTCTTACTAAACCCGAACGCGTAATGAAAGTAAAGGCCGGTCCTGGCATCGGCTTAGGCGAGATCGGGTGGCCTCGCGCCGCCCGCGCATCGCCGGCCCGTCTTAGTCTCGACGCAGACGAGGCGGAGCACGAGCATATACGCTGCGACCCGAAAGATGGTGAACTATGCTTGAATAGGACGAAGTCAGAGGAAACTCTGATGGAGGTCCGTAGCGAATCTGACGTGCAAATCGATCGTCAAATTTGAGTATAGGGGCGAAAGACTAA