Report of Systematic Zoology Lab Practicum, June, 2012
Cytochrome c oxidase subunit I partial sequence of Flabellina athadona (Bergh, 1875) (Opisthobranchia: Aeolidoidea)
Azusa Yoshida
Division of Biology, Department of Biological Sciences, School of Science, Hokkaido University, Sapporo 060-0810, Japan
Material and Methods
Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W. and Lipman, D. J. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 25: 3389–3402. Bergh, R. 1875. Beiträge zur Kenntniss der Aeolidiaden. III. Verhandlungen der Kaiserlich-Königlichen Zoologisch-Botanischen Gesellschaft in Wien 25: 633–658.[Biodiversity Heritage Library] Boom, R., Sol, C. J. A., Salimans, M. M. M., Jansen, C. L., Wertheim-van Dillen, P. M. E., and van der Noordaa, J. 1990. Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology 28: 495–503. Folmer, O., Black, M., Hoeh, W., Lutz, R. and Vrijenhoek, R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: Molecular Evolutionary Genetics Analysis Using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods.
Molecular Phylogenetics and Evolution 24: 1596–1599.
ATATGATGTGGGTTAGCCGGAACTGGGTTAAGGTTGCTGATTCGGTTTGAATTAGGAACAGCTGGGGCTCTTTTAGGTGACGATCACTTATACAATGTGATTGTGACAGCTCATGCTTTTGTGATAATTTTTTTTATGGTTATACCTTTAATAATTGGTGGATTCGGTAATTGAATAGTTCCTTTATTGATTGGTGCTCCTGATATGAGTTTTCCTCGTATAAATAATATAAGGTTTTGGTTATTACCTCCTTCTTTTATTTTACTTATGTCTTCTACTTTAATAGAGGGGGGAGCTGGCACTGGGTGAACTGTGTACCCGCCTCTTTCTGGGGCTATTGGGCACGGAGGATGTTCAGTAGATCTAGCTATTTTTTCTTTGCATTTAGCAGGGATGTCTTCTTTACTAGGGGCAATTAATTTTATTACTACTATTTTTAATATGCGTTCTCCTGAGATAACTATAGATCGTTTAAGGTTGTTTGTGTGATCAGTAATGGTTACAGCTGTTCTTTTACTCTTGTCGCTTCCTGTCTTAGCGGGGGCTATTACTATGCTCTTAACTGATCGGAATTTTAATACTAGGTTCTTCGATCCTGC
A sea slug was obtained intertidally at Oshoro Bay, Hokkaido, Japan, about 43°12′N, 140°51′E, on 25 June 2012 by Azusa Yoshida, photographed and identified by Hiroshi Kajihara as Flabellina athadona (Bergh, 1875), and fixed in 99% EtOH. DNA was extracted from posterior half of the body using the silica method (Boom et al. 1990) with some modifications. Extracted DNA was dissolved in 30 µl of deionized water and has been preserved at –20°C. Remaining morphological voucher specimen has been deposited at the Hokkaido University Museum under the catalogue number ICHU22100299 (contact: Dr. Hiroshi Kajihara, kazi@mail.sci.hokudai.ac.jp).
An about 600-bp fragment of mitochondrial cytochrome c oxidase subunit I gene (COI) was amplified by polymerase chain reaction (PCR) using LCO1490 (5′-GGTCAACAAATCATAAAGATATTGG-3′) and HCO2198 (5′-TAAACTTCAGGGTGACCAAAAAATCA-3′) (Folmer et al. 1994). A hot start PCR was performed by a thermal cycler, DNA-engine(Bio-Rad), in a 20-µl reaction volume containing 1 µl of template total DNA (approximately 10–100 ng) and 19 µl of premix made with 632-µl deionized water, 80-µl Ex Taq Buffer (TaKara Bio), 64-µl dNTP (each 25 mM), 8-µl each primer (each 10 µM), and 0.1-µl TaKara Ex Taq (5 U/µl, TaKara Bio). Thermal cycling condition comprised an initial denaturation at 95°C for 30 sec; 30 cycles of denaturation at 95°C for 30 sec, annealing at 45°C for 30 sec, and elongation at 72°C for 45°C and a final elongation at 72°C for 7 min.
The PCR product was purified with the silica method (Boom et al. 1990). Both strands were sequenced with a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) following the manufacturer's protocol, using the same primer set as the initial PCR amplification. Sequencing was performed with ABI Prism 3730 DNA Analyzer (Applied Biosystems). Chromatogram and sequence data were operated with MEGA 5 software (Tamura et al. 2011).
Results
A total of 599 bp of COI sequence was determined from Flabellina athadona (see Appendix). A Blast search (Altschul et al. 1997), as implemented in the NCBI website (http://www.ncbi.nlm.nih.gov/), resulted in 88% maximum identity (with 0.0 E value) of the present sequence witw JQ69957, a 658-bp strech of COI sequence from Flabellina fusca (Churchill et al. 2012, unpublished data).
Taxonomy
Phylum Mollusca
Class Gastropoda
Subclass Opisthobranchia
Order Nudibranchia
Suborder Aeolidina
Family Flabellinidae
Genus Flabellina Gray, 1833
Flabellina athadona (Bergh, 1875)
Coryphella athadona Bergh, 1875: 635, pl. XIII, figs 1–13.
(Figs 1, 2)
Fig. 1. Flabellina athadona (Bergh, 1875), ICHU22100299, dorsal veiw, taken in life.
Fig. 2. Flabellina athadona (Bergh, 1875), ICHU22100299, magnification of the head, showing the characteristic Y-shaped white line (indicated by black arrow heads).
References
Appendix
COI sequence from ICHU22100299 identidied as Flabellina athadona (Bergh, 1875) (599 bp).