Report of Systematic Zoology Lab Practicum, Volume 4: e10; August, 2013
Cytochrome c oxidase subunit I partial sequence of cf. Caprella scaura (Arthropoda: Crustacea: Caprellidae) from Oshoro, Hokkaido, Japan
Takuya Teranishi and Haruka Okamura
Division of Biology, Department of Biological Sciences, School of Science, Hokkaido University, Sapporo 060-0810, Japan
Material and Methods
Boom, R., Sol, C. J. A., Salimans, M. M. M., Jansen, C. L., Wertheim-van Dillen, P. M. E., and van der Noordaa, J. 1990. Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology 28: 495–503. Folmer, O., Black, M., Hoeh, W., Lutz, R. and Vrijenhoek, R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: Molecular Evolutionary Genetics Analysis Using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods.
Molecular Phylogenetics and Evolution 24: 1596–1599. Takeuchi, I. 1995. Caprellidea. Pp. 193–205. In: Nishimura, S. (Ed.) Guide to Seashore Animals of Japan with Color Pictures and Keys, Vol. II. Hoikusha, Osaka.
GACCCTTTACTTCATACTTGGTGTATGAGCAGCTTTTTTCGGTACGTCCTTAAGGGTTATTATTCGGACTGAATTAATAACACCCGGGAATGTCATTGGAGACGATCAAATCTATAATGTAGTGGTGACTGCCCATGCTTTTATTATAATTTTTTTCATAGTTATACCGGTTATGATTGGGGGTTTTGGTAATTGACTTGTACCTCTTATGTTGGGTAGCCCTGATATAGCTTTTCCTCGTATAAATAATATAAGATTTTGACTCCTTCCTCCTTCTCTGACCCTATTAATCGTTAGAGGTTTAGTAGAAAGAGGGGTAGGAACAGGCTGAACAGTCTACCCGCCCTTGAGGTCAAGAAGGGGACACCCAGGCGCAGCAGTCGACTTAGCTATTTTTTCGCTACACTTAGCAGGTGCTAGGTCTATCTTGGGGGCCATTAATTTTATCTCAACTATCTTAAATATACGAGCAGATTCTATATACCTTGACCGCATACCTTTATTCGTATGGTCAGTTTTTATTACCGCTATTTTGTTACTCTTATCTTTACCTGTTTTAGCGGGCGCTATTACTATACTTCTTACTGACCGTAACTTAAACACATCTTTTTTTGACCCTTTGGGTGGTGGAGACCCTATTTTATACCAACATTTATTT
A skelton shrimp was obtained intertidally in Oshoro Bay, Hokkaido, Japan, about 43°12′N, 140°51′E, on 3 June 2013 by Takuya Teranishi and Haruka Okamura. It was photographed alive with a Nikon COOLPIX 995 digital camera by Hiroshi Kajihara and fixed in 99% EtOH; the specimen was tentatively identified as Caprella scaura Templeton, 1836 by a reference to Takeuchi (1995). DNA was extracted from posterior half of the body using the silica method (Boom et al. 1990) with some modifications. Extracted DNA was dissolved in 30 µl of deionized water and has been preserved at –20°C. Remaining morphological voucher specimen has been deposited at the Hokkaido University Museum under the catalogue number ICHU2110723 (contact: Dr. Hiroshi Kajihara, kazi@mail.sci.hokudai.ac.jp).
An about 700-bp fragment of mitochondrial cytochrome c oxidase subunit I gene (COI) was amplified by polymerase chain reaction (PCR) using LCO1490 (5′-GGTCAACAAATCATAAAGATATTGG-3′) and HCO2198 (5′-TAAACTTCAGGGTGACCAAAAAATCA-3′) (Folmer et al. 1994). A hot start PCR was performed by a thermal cycler, 2720 Thermal Cycler (Applied Biosystems), in a 20-µl reaction volume containing 1 µl of template total DNA (approximately 10–100 ng) and 19 µl of premix made with 632-µl deionized water, 80-µl Ex Taq Buffer (TaKara Bio), 64-µl dNTP (each 25 mM), 8-µl each primer (each 10 µM), and 0.1-µl TaKara Ex Taq (5 U/µl, TaKara Bio). Thermal cycling condition comprised an initial denaturation at 95°C for 30 sec; 30 cycles of denaturation at 95°C for 30 sec, annealing at 45°C for 30 sec, and elongation at 72°C for 45°C and a final elongation at 72°C for 7 min.
The PCR product was purified with the silica method (Boom et al. 1990). Both strands were sequenced with a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) following the manufacturer's protocol, using the same primer set as the initial PCR amplification. Sequencing was performed with ABI Prism 3730 DNA Analyzer (Applied Biosystems). Chromatogram and sequence data were operated with MEGA 5 software (Tamura et al. 2011).
Results
After eliminating the primer sites, a total of 658 bp of COI sequence was determined from cf. Caprella scaura (see Appendix).
Taxonomy
Phylum Arthropoda
Class Malacostraca
Order Amphipoda Latreille, 1816
Family Caprellidae Leach, 1814
Genus Caprella Lamarck, 1801
cf. Caprella scaura (Templeton, 1836)
(Figs 1–3)
Fig. 1. cf. Caprella scaura (Templeton, 1836), ICHU2110723, dorsal veiw, taken in life.
Fig. 2. cf. Caprella scaura (Templeton, 1836), ICHU2110723, lateral veiw, taken in life.
Fig. 3. cf. Caprella scaura (Templeton, 1836), ICHU2110723, magnification of the head.
References
Appendix
Partial sequence (658 nucleotides) of the mitochondrial COI gene from ICHU2110723 identidied as cf. Caprella scaura (Templeton, 1836) collected in Oshoro Bay, Hokkaido, northern Japan.