Report of Systematic Zoology Lab Practicum, Volume 4: e15; August, 2013
Cytochrome c oxidase subunit I gene partial sequence of the Mediterranean mussel Mytilus galloprovincialis (Mollusca: Bivalvia) from Oshoro Bay, Hokkaido, northern Japan
Masaki Miyajima and Akane Ito
Division of Biology, Department of Biological Sciences, School of Science, Hokkaido University, Sapporo 060-0810, Japan
Material and Methods
Boom, R., Sol, C. J. A., Salimans, M. M. M., Jansen, C. L., Wertheim-van Dillen, P. M. E., and Van der Noordaa, J. 1990. Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology 28: 495–503. Folmer, O., Black, M., Hoeh, W., Lutz, R., and Vrijenhoek, R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299. Kurozumi, T. 2000. Mytilidae. Pp. 863–877. In: Okutani, T. (Ed.) Marine Mollusks in Japan. Tokai University Press, Tokyo. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., and Kumar, S. 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28: 2731–2739. GACTCTTTATCTATATAGTGGGGTCTGAGGAGGTTTGTTCGGGGCAAGGTTAAGTCTGATAATTCGGATACAGTTAGGGCATCCTGGAGCAGTATTTTTAAAAAGAGATTGGTTTTATAATGTGGTTGTTACAACACACGCCTTAATAATAATTTTCTTTGCTGTAATACCCATTCTAATCGGAGCTTTCGGTAATTGGCTGATTCCTCTATTAGTAGGTGGTAAAGATATAATTTATCCGCGGATAAATAATTTGAGCTATTGGTTATCTCCTAATGCGCTATACTTACTTATATTATCTTTTAGAACGGATAAAGGGGTAGGTGCTGGATGGACTATTTACCCGCCATTGTCTGTATATCCTTATCATAGCGGGCCGAGGATAGATGTTCTTATTGTGTCCTTGCATTTAGCTGGGTTAAGTTCTTTGGTGGGTGCTATTAATTTTGCTAGTACCAACAAAAACATACCAGTTTTAGAGATAAAAGGAGAACGAGCTGAGCTTTATGTCCTAAGGATTAGAGTTACTGCCGTATTACTAATTATTTCTATTCCGGTTTTAGGAGGGGGTATCACAATAATTCTGTTTGATCGGAACTTTAACACAACATTTTTTGATCCAGCAGGAGGGGGTGACCCTGTCTTGTTTCAACATTTGTTC
A Mediterranean mussel was obtained at a tide pool in Oshoro Bay, Hokkaido, Japan, about 43°2115′N, 140°8553′E, on 3 July 2013 by Masaki Miyajima and Akane Ito, photographed by Takumi Onish with a Nikon D5100 digital camera, and fixed in 99% EtOH. The specimen was later identified by Hiroshi Kajihara as Mytilus galloprovincialis Lamarck, 1819 by a reference to Kurozumi (2000). Total DNA was extracted from the adductor muscle using the silica method (Boom et al. 1990) with some modifications. Extracted DNA was dissolved in 30 µl of deionized water and has been preserved at –20°C. Remaining morphological voucher specimen has been deposited at the Hokkaido University Museum under the catalogue number ICHU2112006 (contact: Dr. Hiroshi Kajihara, kazi@mail.sci.hokudai.ac.jp).
An about 700-bp fragment of mitochondrial cytochrome c oxidase subunit I gene (COI) was amplified by polymerase chain reaction (PCR) using LCO1490 (5′-GGTCAACAAATCATAAAGATATTGG-3′) and HCO2198 (5′-TAAACTTCAGGGTGACCAAAAAATCA-3′) (Folmer et al. 1994). A hot start PCR was performed by a thermal cycler, 2720 Thermal Cycler (Applied Biosystems), in a 20-µl reaction volume containing 1 µl of template total DNA (approximately 10–100 ng) and 19 µl of premix made with 632-µl deionized water, 80-µl Ex Taq Buffer (TaKara Bio), 64-µl dNTP (each 25 mM), 8-µl each primer (each 10 µM), and 0.1-µl TaKara Ex Taq (5 U/µl,TaKara Bio). Thermal cycling condition comprised an initial denaturation at 95°C for 30 sec; 30 cycles of denaturation at 95°C for 30 sec, annealing at 45°C for 30 sec, and elongation at 72°C for 45 sec; and a final elongation at 72°C for 7 min.
The PCR product was purified with the silica method (Boom et al. 1990). Both strands were sequenced with a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) following the manufacturer's protocol, using the same primer set as the initial PCR amplification. Sequencing was performed with ABI Prism 3730 DNA Analyzer (Applied Biosystems). Chromatogram and sequence data were operated with MEGA v5 software (Tamura et al. 2011).
Results
After eliminating the primer sites, a total of 661 bp of COI sequence was determined from Mytilus galloprovincialis (see Appendix).
Taxonomy
Phylum Mollusca
Class Bivalvia
Subclass Pteriomorphia
Order Mytilida
Family Mytilidae Rafinesque, 1815
Genus Mytilus Linnaeus, 1758
Mytilus galloprovincialis Lamarck, 1819
[Japanse name: murasaki-igai]
(Figs 1)
Fig. 1. Mytilus galloprovincialis Lamarck, 1819 (ICHU2112006), collected in Oshoro Bay, Hokkaido, northern Japan.
References
COI sequence (661 bp) from ICHU2112006 identidied as Mytilus galloprovincialis Lamarck, 1819, collected in Oshoro Bay, Hokkaido, Japan.