Report of Systematic Zoology Lab Practicum, August, 2010
Cytochrome c oxidase subunit I partial sequencie of Apseudomorpha sp. (Crustacea: Tanaidacea: Metapseudidae)
Tomoko Nagai
Division of Biology, Department of Biological Sciences, School of Science, Hokkaido University, Sapporo 060-0810, Japan
Material and Methods
Boom, R., Sol., C. J. A., Salimans, M. M. M., Jansen, C. L., Wertheim-van Dillen, P. M. E., and van der Noordaa, J. 1990. Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology28: 495–503. Folmer, O., Black, M., Hoeh, W., Lutz, R. and Vrijenhoek, R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299. Tamura, K.,Dudley, J., Nei, M. and Kumar, S. 2007. MEGA4: Molecullar Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Phylogenetics and Evolution 24: 1596–1599. CTCCCCCTCCCGACGGATCAAAAAATGAAGTATTCAGATTTCGATCTATTAATAATATTGTAATTCCCCCGGCCAATACAGGCAATGACAATAAGAGAAGAATAGCCGTGATAAAAACGGACCATACAAATAATGTGAGATGTTCAAAATGAGTGTTTTTAGGCTTAAGAGCAGAAATAGTAGTAATAAAATTAACAGCTCCTAAAATAGAAGATGCCCCAGCCAAATGAAGAGAGAAAATTGCAAGGTCAACTGACGGACCCGGGTGAAAATTTTCAGTAGAAAGAGGAGGATAGACAGTTCAACCTGTCCCAACTCCTCCTTCAACTATACCTCTTAGAAGTAAAAGAACTAGAGCGGGAGGCAATAATCAAAATCTAAGATTGTTTATTC
A tanaidacean was obtained among Mytilus bed at Oshoro Bay, Hokkaido, Japan, about 43°12′N, 140°51′E, on 24 May 2010 by Tomoko Nagai, photographed by Hiroshi Kajihara and fixed in 99% EtOH. The specimen was later identified as a member of the genus Apseudomorpha by Keiichi Kakui based on the photographs. DNA was extracted from the entire specimen, using the silica method (Boom et al. 1990) with some modifications. Extracted DNA was dissolved in 30 µl of deionized water and has been preserved at –20°C.
An about 600-bp fragment of mitochondrial cytochrome c oxidase subunit I gene (COI) was amplified by polymerase chain reaction (PCR) using LCO1490
(5′-GGTCAACAAATCATAAAGATATTGG-3′) and HCO2198 (5′-TAAACTTCAGGGTGACCAAAAAATCA-3′)
(Folmer et al. 1994). A hot start PCR was performed by a thermal cycler, iCycler (Bio-Rad), in a 20-µl reaction volume containing 1 µl of template total DNA (approximately 10–100 ng)
and 19 µl of premix made with 632-µl deionized water, 80-µl Ex Taq Buffer (TaKara Bio), 64-µl dNTP (each 25 mM), 8-µl each primer (each 10 µM), and 0.1-µl TaKara Ex Taq (5 U/µl,TaKara Bio). Thermal cycling condition comprised an initial
denaturation at 95°C for 30 sec; 30 cycles of denaturation at 95°C for 30 sec, annealing at 45°C for 30 sec, and elongation at 72°C for 45°C and a final elongation at 72°C for 7 min.
The PCR product was purified with the silica method (Boom et al. 1990). Both strands were sequenced with a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) following the manufacturer's protocol, using the same primer set as the initial PCR amplification. Sequencing was performed with ABI Prism 3730 DNA Analyzer (Applied Biosystems). Chromatogram and sequence data were operated with MEGA v4 software (Tamura et al. 2007).
Results
A total of 408 bp of COI sequence was determined from Apseudomorpha sp. (see Appendix).
Taxonomy
Order Tanaidacea Dana, 1849
Family Metapseudidae Lang, 1970
Genus Apseudomorpha Miller, 1940
Apseudomorpha sp.
(Figs 1–3)
Fig. 1. Apseudomorpha sp. (ICHU22080033), ventral view.
Fig. 1. Apseudomorpha sp. (ICHU22080033), dorsal view.
Fig. 1. Apseudomorpha sp. (ICHU22080033), dorso-lateral view.
References
Appendix
COI sequence from ICHU22080033 identidied as Apseudomorpha sp.