Report of Systematic Zoology Lab Practicum, August, 2010
Cytochrome c oxidase subunit I partial sequence of Notoplana humilis (Turbellaria: Polycladida: Leptoplanidae)
Takaaki Suzuki
Division of Biology, Department of Biological Sciences, School of Science, Hokkaido University, Sapporo 060-0810, Japan
Material and Methods
Boom, R., Sol, C. J. A., Salimans, M. M. M., Jansen, C. L., Wertheim-van Dillen, P. M. E., and van der Noordaa, J. 1990. Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology 28: 495–503. Folmer, O., Black, M., Hoeh, W., Lutz, R. and Vrijenhoek, R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299. Nomura, N. 1992. Platyhelminthes. Pp. 175–193. In: Nishimura, S. (Ed.) Guide to Seashore Animals of Japan with Color Pictuers and Keys. Vol. I. Hoikusha, Osaka.
Tamura, K., Dudley, J., Nei, M. and Kumar, S. 2007. MEGA4: Molecullar Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Phylogenetics and Evolution 24: 1596–1599. CCCCTCCTGCTGGATCAAAAAATGTTGTGTTAAAGTTCCGATCAAACAGAATTATTGTGATACCCCCTCCTAAAACCGGAATAGAAATAATTAGTAATACGGCAGTAACTCTAATCCTTAGGACATAAAGCTCAGCTCGTTCTCCTTTTATCTCTAAAACTGGTATGTTTTTGTTGGTACTAGCAAAATTAATAGCACCCACCAAAGAACTTAACCCAGCTAAATGCAAGGACACAATAAGAACATCTATCCTCGGCCCGCTATGATAAGGATATACAGACAATGGCGGGTAAATAGTCCATCCAGCACCTACCCCTTTATCCGTTCTAAAAGATAATATAAGTAAGTATAGCGCATTAGGAGATAACCAATAGCTCAAATTATTTATCCGCGGATAAATTATATCTTTACCACCTACTAATAGAGGAATCAGCCAATTACCGAAAGCTCCGATTAGAATGGGTATTACAGCAAAGAAAATTATTATTAAGGCGTGTGTTGTAACAACCACATTATAAAACCAATCTCTTTTTAAAAATACTGCTCCAGGATGCCCTAACTGTATCCGAATTATCAGACTTAACCTTGCCCCGAACAAACCTCCTCAGACCCCACTATATAGATAAAGAGTCCCAATATCTTATTA
A polyclad specimen was obtained among the blue mussels Mytilus galloprovincialis Lamarck, 1819 in Oshoro Bay, Hokkaido, Japan, about 43°12′N, 140°51′E, on 24 May 2010 by Takaaki Suzuki, photographed and identified by Hiroshi Kajihara as Notoplana humilis based on Nunomura (1992a: 186, pl. 43, fig. 4), and fixed in 99% EtOH. DNA was extracted from the posterior half of the body using the silica method (Boom et al. 1990) with some modifications. Extracted DNA was dissolved in 30 µl of deionized water and has been preserved at –20°C. Remaining morphological voucher specimen has been deposited at the Hokkaido University Museum under the catalogue number ICHU22080077 (contact: Dr. Hiroshi Kajihara, kazi@mail.sci.hokudai.ac.jp).
An about 650-bp fragment of mitochondrial cytochrome c oxidase subunit I gene (COI) was amplified by polymerase chain reaction (PCR) using LCO1490 (5′-GGTCAACAAATCATAAAGATATTGG-3′) and HCO2198 (5′-TAAACTTCAGGGTGACCAAAAAATCA-3′) (Folmer et al. 1994). A hot start PCR was performed by a thermal cycler, iCycler (Bio-Rad), in a 20-µl reaction volume containing 1 µl of template total DNA (approximately 10–100 ng) and 19 µl of premix made with 632-µl deionized water, 80-µl Ex Taq Buffer (TaKara Bio), 64-µl dNTP (each 25 mM), 8-µl each primer (each 10 µM), and 0.1-µl TaKara Ex Taq (5 U/µl,TaKara Bio). Thermal cycling condition comprised an initial denaturation at 95°C for 30 sec; 30 cycles of denaturation at 95°C for 30 sec, annealing at 45°C for 30 sec, and elongation at 72°C for 45°C and a final elongation at 72°C for 7 min.
The PCR product was purified with the silica method (Boom et al. 1990). Both strands were sequenced with a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) following the manufacturer's protocol, using the same primer set as the initial PCR amplification. Sequencing was performed with ABI Prism 3730 DNA Analyzer (Applied Biosystems). Chromatogram and sequence data were operated with MEGA v4 software (Tamura et al. 2007).
Results and Discussion
A total of 647 bp of COI sequence was determined (see Appendix). However, a nucleotide BLAST search of this sequence at the National Center for Biotechnology Information indicated that it represented the blue mussel Mytilus galloprovincialis. This suggests that the flatworm ate a blue mussel just before the former was fixed, and the PCR-enhanced DNA derived from the mussel tissue that remained in the digestive tract of the flatworm.
Taxonomy
Order Polycladida
Family Leptoplanidae
Genus Notoplana
Notoplana humilis (Stimpson, 1857)
(Figs 1, 2)
Fig. 1. Notoplana humilis (ICHU22080077), showing a pair of patches of black ocelli.
Fig. 2. Notoplana humilis (ICHU22080077), dorsal view.
References
Appendix
COI sequence from ICHU22080077, identified as the flatworm Notoplana humilis (Stimpson, 1857), although the sequence most probably represents the blue mussel Mytilus galloprovincialis Lamarck, 1819.