Report of Systematic Zoology Lab Practicum, August, 2011


Partial sequences of 28S rDNA from the flat worm Notocomplana humilis (Turbellaria: Polycladida: Notoplanidae).


Nanako Matsuzawa

Division of Biology, Department of Biological Sciences, School of Science, Hokkaido University, Sapporo 060-0810, Japan



Material and Methods
A polyclad specimen was obtained among the blue mussels( Mytilus cf. galloprovincialis Lamarck, 1819) in Oshoro Bay, Hokkaido, Japan, about 43°12&min;N, 140°51&min;E, on 24 May 2010 by Nanako Matsuzawa, photographed and identified by Hiroshi Kajihara as Notoplana humilis, and fixed in 99% EtOH. DNA was extracted from the body using the silica method (Boom et al. 1990) with some modifications. Extracted DNA was dissolved in 30 µn;l of deionized water.
      An about 1.2K-bp fragment of 28S rRNA gene was amplified by polymerase chain reaction (PCR) using LSU5 (5′-ACCCGCTGAAYTTAAGCA-3′) and LSU3 (5′-TCCTGAGGGAAACTTCGG-3′) (Littlewoodet al. 1994). A hot start PCR was performed by a thermal cycler, iCycler (Bio-Rad), in a 20-µn;l reaction volume containing 1 µn;l of template total DNA (approximately 10–100 ng) and 19 µn;l of premix made with 632-µn;l deionized water, 80-µn;l Ex Taq Buffer (TaKara Bio), 64-µn;l dNTP (each 25 mM), 8-µn;l each primer (each 10 µn;M), and 0.1-µn;l TaKara Ex Taq (5 U/µn;l,TaKara Bio). Thermal cycling condition comprised an initial denaturation at 95°C for 30 sec; 30 cycles of denaturation at 95°C for 30 sec, annealing at 45°C for 30 sec, and elongation at 72°C for 45°C and a final elongation at 72°C for 7 min.
      The PCR product was purified with the silica method (Boom et al. 1990). Both strands were sequenced with a BigDyeR Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) following the manufacturer's protocol, using the same primer set as the initial PCR amplification. Sequencing was performed with ABI Prism 3730 DNA Analyzer (Applied Biosystems). Chromatogram and sequence data were operated with MEGA v4 software (Tamura et al. 2007).

Results
Two regions of 28S rDNA sequence, 769 bp and 763 bp, respectively, were determined from Notoplana humilis (Stimpson, 1857) (see Appendix).

Taxonomy
Phylum Platyhelminthes
Class Turbellaria
Order Polycladida
Family Notoplanidae
Genus Notocomplana Fauble, 1983
Notocomplana humilis (Stimpson, 1857)
(Figs 1, 2)

Leptoplana humilis Stimpson, 1857
Notoplana humilis (Stimpson, 1857)



Fig. 1. Notocomplana humilis (ICHU22080207), showing a pair of patches of black ocelli.



Fig. 2. Notocomplana humilis (ICHU22080207), dorsal view.



References

Boom, R., Sol, C. J. A., Salimans, M. M. M., Jansen, C. L., Wertheim-van Dillen, P. M. E., and van der Noordaa, J. 1990. Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology 28: 495–503.

Folmer, O., Black, M., Hoeh, W., Lutz, R. and Vrijenhoek, R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299.

Nomura, N. 1992. Platyhelminthes. Pp. 175–193. In: Nishimura, S. (Ed.) Guide to Seashore Animals of Japan with Color Pictuers and Keys. Vol. I. Hoikusha, Osaka.

Stimpson, W. 1857. Prodromus descriptionis animalium evertebratorum quae in Expeditione ad Oceanum Pacificum Septentrionalem, Johanne Rodgers Duce a Republica Federata missa, observavit et descripsit. Pars. I. Turbellaria Dendrocoela. Proceedings of the Academy of Natural Sciences of Philadelphia 9: 19–31.

Tamura, K., Dudley, J., Nei, M. and Kumar, S. 2007. MEGA4: Molecullar Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Phylogenetics and Evolution 24: 1596–1599.




Appendix
Two regions of 28S rDNA from ICHU22080077, identified as the flatworm Notocomplana humilis (Stimpson, 1857).

GCTACTTCCACCACAGACTTTCGACGCCAATCGCAGAGGCCACGCATTCTAACCGACGCATCTCCAACTCCCCTGCCAAAGGCAGTGAAACCGGCGACACACCTGAAAGAGGCAACGTACGAGCCCAAAGGGCAAGCGCCAACTCATCGCATCCAACGCCTCGCTCAACTACCGAATAGGCGGCTATAACACGTTCGCCGAAGCCAACGCTACCTTCCGACCCATGTCAGGCAAGACAAGTCGCTGGTCGTGGTCCGATCAAGAAGAAAGTGCACCTATCCCGCACGAAGATGCCGCCAGCGGAGTCGTGAGATCTCACAACCGACGTCAACTCTAGCAGGAAGGGCTGAATTCCTCAAGACCATTTCAGCTCCACCAGTTTGCCTCTCAGCGGTTTCACGTACTCTTGAACTCTCTCTTCAAAGTTCTTTTCAACTTTCCCTCGCGGTACTTCTTCGCTATCGGACTCGTGCTAGTATTTAGCCTTGGATGGAGTTTACCACCCGCTTTGGGCTGCATTCCCAAACAACCCGACTCTAAGGACGTACCGGGCACCGGACGACTCGCCTCCACGGGCCTTACACCCTCTCTGGGCCTGAAGCCACAATCAAGTGGACTTGAGGAGAATCATACCGGCACAAAGCACGGCCTAAACACCACATTTCCTAGTATCAGGACGATACAGGATTCGGTGCTGGGCTTTTCCTCGTTCGCTCGCCGTTACTAGAGGAATCCTTGTTAGTTTCTTTTCCTCCGCTTACTGATATGC

AACAGGATTCCTCTAGTAACGGCGAGCGAACGAGGAAAAGCCCAGCACCGAATCCTGTATCGTCCTGATACTAGGAAATGTGGTGTTTAGGCCGTGCTTTGTGCCGGTATGATTCTCCTCAAGTCCACTTGATTGTGGCTTCAGGCCCAGAGAGGGTGTAAGGCCCGTGGAGGCGAGTCGTCCGGTGCCCGGTACGTCCTTAGAGTCGGGTTGTTTGGGAATGCAGCCCAAAGCGGGTGGTAAACTCCATCCAAGGCTAAATACTAGCACGAGTCCGATAGCGAAGAAGTACCGCGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGCTGAGAGGCAAACTGGTGGAGCTGAAATGGTCTTGAGGAATTCAGCCCTTCCTGCTAGAGTTGACGTCGGTTGTGAGATCTCACGACTCCGCTGGCGGCATCTTCGTGCGGGATAGGTGCACTTTCTTCTTGATCGGACCACGACCAGCGACTTGTCTTGCCTGACATGGGTCGGAAGGTAGCGTTGGCTTCGGCGAACGTGTTATAGCCGCCTATTCGGTAGTTGAGCGAGGCGTTGGATGCGATGAGTTGGCGCTTGCCCTTTGGGCTCGTACGTTGCCTCTTTCAGGTGTGTCGCCGGTTTCACTGCCTTTGGCAGGGGAGTTGGAGATGCGTCGGTTAGAATGCGTGGCCTCTGCGATTGGCGTCGAAAGTCTGTGGTTGTGAAGTAGGCAGTCCACCTGACCCGTCTTGA