Report of Systematic Zoology Lab Practicum, July, 2011
28S rDNA sequence of an unidentified species of gammaroid (Crustacea: Amphipoda: Gammaroidea)
Ryohei Niizawa
Division of Biology, Department of Biological Sciences, School of Science, Hokkaido University, Sapporo 060-0810, Japan
Material and Methods Boom, R., Sol, C. J. A., Salimans, M. M. M., Jansen, C. L., Wertheim-van Dillen, P. M. E., and van der Noordaa, J. 1990. Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology 28: 495–503. Folmer, O., Black, M., Hoeh, W., Lutz, R. and Vrijenhoek, R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299. Littlewood, D. T. 1994. Molecular phylogenetics ofcupped oysters based on partial 28S rRNA gene sequences. Molecular Phylogenetics and Evolution 3: 221–229. Tamura, K., Dudley, J., Nei, M. and Kumar, S. 2007. MEGA4: Molecullar Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Phylogenetics and Evolution 24: 1596–1599.
AAAAGCCTGTGGCGAAATGTCGCGTTAAGAGAGAGATCGTTGTGAAACCCTACAGCTACGCGATCGCTAAGTACTGCCACGAGTGGTAATCCCGACGAAAGGAGGGAATGTGTCACCGTGGAGGGTATGAGTCCCGTGTGGACGCGTATTAGAGTGCTGTATAAAGGGTAAGGTCTTCCTCTCTGCGAGTCGCGTTGCTTGCACATGCAGCGCTAAGCAGGTCGTAAATTCGATCTAAGGCTAAATATACTCACAGAACCGATAGCAAACTAGTACCGCAAGGGAAAGTTGAAAAGGACTCTGGAGAGAGGGTCAAAAGAACGTGAAACCGCTTAGAGTATAAACCGAAGGCGCTAGAAGGAACACGGAATGCGTGGACACTCAATTTGTGCGTGTGTGTCGACGTTCGTTTATATTCCGTTCAAGTCCCGCCACAGTTCTTTATTTGATCACGGACTATGGT-TATACGCGCTCGTATCCGACTAGCATGC
A gammaroid specimen was obtained among laminarian holdfast at Oshoro Bay, Hokkaido, Japan, about 43°12′N, 140°51′E, on 30 May 2010 by Ryohei Niizawa, photographed by Hiroshi Kajihara, and fixed in 99% EtOH. DNA was extracted using the silica method (Boom et al. 1990) with some modifications. Extracted DNA was dissolved in 30 µn;l of deionized water and has been preserved at –20°C. Remaining morphological voucher specimen has been deposited at the Hokkaido University Museum under the catalogue number ICHU22090091 (contact: Dr. Hiroshi Kajihara, kazi@mail.sci.hokudai.ac.jp).
Amplification of mitochondrial cytochrome c oxidase subunit I gene (COI) using LCO1490 (5′-GGTCAACAAATCATAAAGATATTGG-3′) and HCO2198 (5′-TAAACTTCAGGGTGACCAAAAAATCA-3′) (Folmer et al. 1994) was unsuccessful.
An about 1.2K-bp fragment of 28S rRNA gene was amplified by polymerase chain reaction (PCR) using LSU5 (ACCCGCTGAAYTTAAGCA) and LSU3 (TCCTGAGGGAAACTTCGG) (Littlewood. 1994). A hot start PCR was performed by a thermal cycler, iCycler (Bio-Rad), in a 20-µn;l reaction volume containing 1 µn;l of template total DNA (approximately 10?100 ng) and 19 µn;l of premix made with 632-µn;l deionized water, 80-µn;l Ex Taq Buffer (TaKara Bio), 64-µn;l dNTP (each 25 mM), 8-µn;l each primer (each 10 µn;M), and 0.1-µn;l TaKara Ex Taq (5 U/µn;l,TaKara Bio). Thermal cycling condition comprised an initial denaturation at 95°C for 30 sec; 30 cycles of denaturation at 95°C for 30 sec, annealing at 45°C for 30 sec, and elongation at 72°C for 45°C and a final elongation at 72°C for 7 min.
The PCR product was purified with the silica method (Boom et al. 1990). Both strands were sequenced with a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) following the manufacturer's protocol, using the same primer set as the initial PCR amplification. Sequencing was performed with ABI Prism 3730 DNA Analyzer (Applied Biosystems). Chromatogram and sequence data were operated with MEGA v4 software (Tamura et al. 2007).
Results
A total of 491 bp of 28S rDNA partial sequence was determined (see Appendix).
Taxonomy
Phylum Arthropoda
Subphylum Crustacea
Class Malacostraca
Order Amphipoda
Infraorder Gammarida
(Figs 1–4)
Fig. 1. Gammarida sp., ICHU22090091.
Fig. 2. Gammarida sp., ICHU22090091.
Fig. 3. Gammarida sp., ICHU22090091.
Fig. 4. Gammarida sp., ICHU22090091.
References
28S rDNA sequence (491 bp) from Gammarida sp., ICHU22090091.