Report of Systematic Zoology Lab Practicum, August, 2011


28S rDNA partial sequence of Achelia japonica (Arthropoda: Pycnogonida)


Yukino Miyoshi

Division of Biology, Department of Biological Sciences, School of Science, Hokkaido University, Sapporo 060-0810, Japan



Material and Methods
A pycnogonid specimen was obtained subtidally at Oshoro Bay, Hokkaido, Japan, about 43°12′N, 140°51′E, on 30 May 2011 by Yukino Miyoshi, then photographed and identified by Hiroshi Kajihara as Achelia japonica (Ortmann, 1890), before fixed in 99% EtOH. DNA was extracted from the anterior half of the body using the silica method (Boom et al. 1990) with some modifications. Extracted DNA was dissolved in 30 µl of deionized water and has been preserved at –20°C. Remaining morphological voucher specimen has been deposited at the Hokkaido University Museum under the catalogue number ICHU22090101 (contact: Dr. Hiroshi Kajihara, kazi@mail.sci.hokudai.ac.jp).
      An about 1.2K-bp fragment of 28S rRNA gene was amplified by polymerase chain reaction (PCR) using LSU5 (5′-ACCCGCTGAAYTTAAGCA-3′) and LSU3 (5′-TCCTGAGGGAAACTTCGG-3′) (Littlewoodet al. 1994). A hot start PCR was performed by a thermal cycler, iCycler (Bio-Rad), in a 20-µl reaction volume containing 1 µl of template total DNA (approximately 10–100 ng) and 19 µl of premix made with 632-µl deionized water, 80-µl Ex Taq Buffer (TaKara Bio), 64-µl dNTP (each 25 mM), 8-µl each primer (each 10 µM), and 0.1-µl TaKara Ex Taq (5 U/µl,TaKara Bio). Thermal cycling condition comprised an initial denaturation at 95°C for 30 sec; 30 cycles of denaturation at 95°C for 30 sec, annealing at 45°C for 30 sec, and elongation at 72°C for 45°C and a final elongation at 72°C for 7 min.
      The PCR product was purified with the silica method (Boom et al. 1990). Both strands were sequenced with a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) following the manufacturer's protocol, using the same primer set as the initial PCR amplification. Sequencing was performed with ABI Prism 3730 DNA Analyzer (Applied Biosystems). Chromatogram and sequence data were operated with MEGA v5 software (Tamura et al. 2011).

Results
A total of 719 bp of 28S rDNA sequence was determined from ICHU22090101, identified as Achelia japonica (Ortmann, 1890) (see Appendix).

Taxonomy
Phylum Arthropoda
Class Pycnogonida
Family Ammotheidae
Genus Achelia Hodge, 1864
Achelia japonica (Ortmann, 1890)
(Fig. 1)
  Achelia echinata japonica Ortmann, 1890.
  Achelia echinata nasuta Marcus, 1940.
  Achelia echinata orientalis Losina-Losinsky, 1933.
  Achelia echinata sinensis (Lou, 1936).
  Achelia sinensis Lou, 1936.


Fig. 1. Achelia japonica (Ortmann, 1890) (ICHU22090101),


References

Boom, R., Sol., C. J. A., Salimans, M. M. M., Jansen, C. L., Wertheim-van Dillen, P. M. E., and van der Noordaa, J. 1990. Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology 28: 495–503.

Folmer, O., Black, M., Hoeh, W., Lutz, R. and Vrijenhoek, R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299.

Losina-Losinsky, L. K. 1933. Die Pantopoden der östlichen Meere der U.S.S.R. Issledovaniya Faunui Morei 17: 43–80.

Lou, T.-H. 1936. Sur deux nouvelles variétés de Pycnogonides recueillies à Tsing-Tao, dans la baie de Kiao-Chow, Chine. Contributions from the Institute of Zoology, National Academy of Peiping 3(1): 1–34.

Marcus, E. 1940. Os Pantopoda brasileiros e os demais sulamericanos. Boletim da Faculdade de filosofia, ciências e letras, Universidade de São Paulo 19: 3–179.

Ortmann, A. 1890. Bericht über die von Herrn Dr. Döderlein in Japan gesammelten Pycnogoniden. Zoologische Jahrbücher, Abteilung für Systematik, Geographie und Biologie der Tiere 5(1): 157–168.

Tamura, K., Dudley, J., Nei, M. and Kumar, S. 2011. MEGA5: Molecullar Evolutionary Genetics Analysis (MEGA) software version 5.0. Molecular Phylogenetics and Evolution 24: 1596–1599.


Appendix
28S rDNA sequence from ICHU22090101 identidied as Achelia japonica (Ortmann, 1890.

TAACGAGGACTCCCCTAGTAACGGCGAGTGAACGGGGAAGAGCCCAGCGCCGAATCCCGCGACCCCGCAGGAGGGTCGCGTTCGGGACATGTGGCGTTTGGGAGAGACTCGTCCGGCGGGTCGCCGAGGTCGTAGGTCCTCCTGACCGGGGCCAATACCCACGGAGGGTGCTAGGCCCGTATCGACCATGGTGCTCGTCGGACGTTCGCTCCCTAGATTCGGGTTGCTTGAGAGTGCAGCCCTAATAGGGTGGTAGACTCCACCTAAGGCTAAGTACGGCCGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGTTGCAAAGAACTTTGAAGAGAGAGTTCAAAAGTACGTGAAACCGTCTAGAGGCAAACGGGTGGACACTCGAAGCCCAGGCGGGGCGGACTCAACCCGGTCGACGATCGTCGGGCGTCCCGTGCAGATCCTTCCAAGGACTCGCCGGGGCGTCCGTCATCGGTCGCCGTCGGGTGCATTTCCGCTCCCGTCCCAGCGGTCGCCGCGACCGTCAGGATACGCCGGCGTGCAGTCGTTCGGGGAAGACAGCTCGGCCCCTCGTGGGTCTAGTCTTGCAGCCCCGTTCGGCCATCGTCTCGCGCACGGCGTTCCTGGCGAATCGTCATATTCGGACGCTCTCCCTCGTCCACGTTCGAGCCGATCTTCCGGTCTTGCCGCGTCGGGGCTGCCCTCTAGAAAGAGGG