An acmaeid gastropod was obtained among laminarian holdfast at Oshoro Bay, Hokkaido, Japan, about 43°12′N, 140°51′E, on 7 June 2010 by Shotaro Aoe, photographed and identified by Hiroshi Kajihara as Niveotectura pallida (Gould, 1859). DNA was extracted from the EtOH-fixed tissue, using the silica method (Boom et al. 1990) with some modifications. Extracted DNA was dissolved in 30 µl of deionized water and has been preserved at –20°C. Remaining morphological voucher specimen has been deposited at the Hokkaido University Museum under the catalogue number ICHU22090306 (contact: Dr. Hiroshi Kajihara, kazi@mail.sci.hokudai.ac.jp).
Amplification of mitochondrial cytochrome c oxidase subunit I gene (COI) using LCO1490 (5′-GGTCAACAAATCATAAAGATATTGG-3′) and HCO2198 (5′-TAAACTTCAGGGTGACCAAAAAATCA-3′) (Folmer et al. 1994) was unsuccessful.
An about 1.2K-bp fragment of 28S rRNA gene was amplified by polymerase chain reaction (PCR) using LSU5 (ACCCGCTGAAYTTAAGCA) and LSU3 (TCCTGAGGGAAACTTCGG) (Littlewood. 1994). A hot start PCR was performed by a thermal cycler, iCycler (Bio-Rad), in a 20-µl reaction volume containing 1 µl of template total DNA (approximately 10–100 ng) and 19 µl of premix made with 632-µl deionized water, 80-µl Ex Taq Buffer (TaKara Bio), 64-µl dNTP (each 25 mM), 8-µl each primer (each 10 µM), and 0.1-µl TaKara Ex Taq (5 U/µl,TaKara Bio). Thermal cycling condition comprised an initial denaturation at 95°C for 30 sec; 30 cycles of denaturation at 95°C for 30 sec, annealing at 45°C for 30 sec, and elongation at 72°C for 45°C and a final elongation at 72°C for 7 min.
The PCR product was purified with the silica method (Boom et al. 1990). Both strands were sequenced with a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) following the manufacturer's protocol, using the same primer set as the initial PCR amplification. Sequencing was performed with ABI Prism 3730 DNA Analyzer (Applied Biosystems). Chromatogram and sequence data were operated with MEGA v4 software (Tamura et al. 2007).
Results
A total of 778 bp of 28S sequence was determined from Niveotectura pallida (Gould, 1859).
Taxonomy
Phylum Mollusca
Class Gastropoda
Order Prosobranchia
Superfamily Lottioidea
Family Acmaeidae
Genus Niveotectura Habe, 1944
Niveotectura pallida (Gould, 1859)
[Japanese name: yukinokasagai]
(Figs 1–3)
Fig. 1. Niveotectura pallida (Gould, 1859), ICHU22090306, dorsal view.
Fig. 2. Niveotectura pallida (Gould, 1859), ICHU22090306, ventral view.
Fig. 3. Niveotectura pallida (Gould, 1859), ICHU22090306, lateral view.
Appendix
28S rDNA sequence from ICHU22090306 identified as Niveotectura pallida (Gould, 1859).
TAGCGGCGAGCGAAGCGGGAAAAGCCCATCGCCGAATCCCCCGCCGGACCTCGGCGGTTCGGGACCTGTGGCGTAAGGGTCCTACTCGTCGGGCGTCTGACCGTCCGAACAAGTCCCGCGGGACAGGTGTGCTCCCAGAGTGGGTGTGAGGCCTTTAGTTCGGTCTGGGTCTTCTGCCCGGCGCAGTCGGTACCCGAGAGTCGAGTTGCTTGGGATCGCAGCTCAAAGTGGGTGGTAAGCTCCATCTAAGGCTAAATACTTGCACGAGTCCGATAGCGAACAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGACCGTGAAAGCGCCTACGGGCAAACGGGTGGAACCGCCGGTGCGACCAGCGGAATCCAGCTCGCCGGGCTGGCGGCCGCTCTCGGTGTCGGGACTCGACCTTTTCGGAGGCCGGGCTCGGCGCCGCGAGGCGGTCCGTCCCCGTCGGCGTATCTTCCGCTGCTTGTCGCGAGTCGCGACCGGCTCGAAGTGCTTCGTCTCGGCTGGTGTCAGGCGAGGGGCGCGCCTCTCGGGGCGTCGCACTCGTCTTCGGACTGCCTGCTCCGGCCGGCATCACGGCGAACGCAGCTTCGGGCCGAGGAACGGCCCCGTTCTCGCTCCTGACCAAGTCTCCCGGCGACGTCGCGGCCGTCTTGACTGCCTCTTCGAGGCTTAACAGTGCAAGTGCGGTCGCCCGGTCGGCGCCGGCGAGGCGGCAGGTTTGGGGAACGGTTTAGAGGGTCCGCGG