Report of Systematic Zoology Lab Practicum, July, 2012
28S rDNA partial sequence of Leptochelia itoi (Crustacea: Tanaidacea)
Shinya Kawata and Akari Kanda
Division of Biology, Department of Biological Science, School of Science, Hokkaido University, Sapporo 060-0810, Japan
Meterial and Methods
Boom, R., Sol, C. J. A., Salimans, M. M. M., Jansen, C. L., Wertheim-van Dillen, P. M. E., and van der Noordaa, J. 1990. Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology 28: 495–503. Folmer, O., Black, M., Hoeh, W., Lutz, R. and Vrijenhoek, R. 1994. DNA primers for amplification of 28SrRNA from diverse metazoan invertebrates. Molecular Biology and Biotechnology 3: 294–299. Tamura, K., Peterson. D., Peterson, N., Stecher, G., Nei, M., and Kumar, S. 2011. MEGA5: Molecular Evolutionary Genetics Analysis (MEGA) software version 5.05.
Molecular Biology and Evolution28: 2731–2739.
GCAAACAAGGTACCGTGAGGGAAAGTTGAAAAAGAACTCTGAAGAGAGAGTTAAGAGAACGTGAAACCGCTGCTAGTACGTAAAGCGAATGGACATTCGAGGCCATGATTGCCCCGCATCAGATCGGTACGATATGGTTGGAAAGTAGAATCGGAAATGTGTTTATTTTTATCTATTGTTTCCGTATGTCTGCTTTCGTAATCAGCCTATCGCCAGTTTGAATCGCTGGCATGAGGCGGCCGTTTTCATTGATCGGTTATCGGCCCGGCTTAGTTGACTTCGAGGAAATTTTTATAATTTCTCGATAGTTATTAAAGACTATGTCCGCGGCATTATGATGGACCGTGTCGATG
A tanaid was obtained by an Ekman-Birge grab sampler from a muddy bottom at ca. 10 m depth at Oshoro Bay, Hokkaido, Japan, about 43°12′N, 140°51′E on 25 June 2012 by Shinya Kawata and Akari Kanda, photographed by Hiroshi Kajihara, identified as Leptochelia itoi Ishimaru, 1985 by Keiichi Kakui, and fixed in 99% EtOH. DNA was extracted from the entire animal using the silica method (Boom et al. 1990) with some modifications. Extracted DNA was dissolved in 30 µl of deionized water and has been preserved at –20°C.
An about 500-bp fragment of 28SrRNA was amplified by polymerase chain reaction (PCR) using 28Z (5′-CTTTGGTCCGTGTTTCCAAGAC) (Littlewood 1994) and LSU5 (5′-ACCGGCTTATCTGAAAAG-3′) (Hillis et al.). A hot start PCR was performed by a thermal cycler, DNA Engine(Bio-Rad), in a 20-µl reaction volume containing 1 µl of template total DNA (approximately 10–100ng) and 19 µl of premix made with 632-µl deionized water, 80-µl Ex Tag Buffer (TaKara Bio), 64-µl dNTP (each 25 mM), 8-µl each primer (each 10 µM), and 0.1-µl TaKara Ex Tag (5 U/µl, TaKara Bio). Thermal cycling condition comprised an initial denaturation at 95°C for 30 sec; 30 cycles of denaturation at 95°C for 30 sec, annealing at 45 °C for 30 sec, and elongation at 72°C for 45°C and a final elongation at 72°C for 7 min.
The PCR product was purified with the silica method (Boomet al. 1980). Both strands were sequenced with a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) following the manufacturer's protocol, using the same primer set as the initial PCR amplification. Sequencing was performed with ABI Prism 3730 DNA Analyzer (Applied Biosystems). Chromatogram and sequence data were operated with MEGA v5.05 software (Tamura et al. 2011).
Results
A total of 353 bp of 28S rDNA sequence was determined from
Taxonomy
Phylum Arthropoda
Class Malacostraca
Order Tanaidacea
Family Leptochelidae
Genus Leptochelia Dana, 1849
Leptochelia itoi Ishimaru, 1985
(Fig. 1)
Fig. 1. Leptochelia itoi Ishimaru, 1985, ICHU22100262, lateral view.
References
28S rDNA sequence from ICHU22100262, identified as Leptochelia itoi Ishimaru, 1985.