Report of Systematic Zoology Lab Practicum, August, 2012


Cytochrome c oxidase subunit I partial sequence of Trachysalambria curvirostris (Crustacea: Decapoda: Penaeidae)


Ikumasa Ganaha and Ryo Mizuyama

Division of Biology, Department of Biological Sciences, School of Science, Hokkaido University, Sapporo 060-0810, Japan



Material and Methods
A shrimp was collected with an Ekman-Birge grab sampler from the depth of 19 m at a sandy bottom in Oshoro Bay, Hokkaido, Japan, about 43°12′N, 140°51′E, on 25 June 2012 by Ikumasa Ganaha and Ryo Mizuyama, photographed and identified by Hiroshi Kajihara as Trachysalambria curvirostris (Stimpson, 1860), and fixed in 99% EtOH. DNA was extracted from one of the pleopods using the silica method (Boom et al. 1990) with some modifications. Extracted DNA was dissolved in 30 µl of deionized water and has been preserved at –20°C. Remaining morphological voucher specimen has been deposited at the Hokkaido University Museum under the catalogue number ICHU22100242 (contact: Hiroshi Kajihara, kazi@mail.sci.hokudai.ac.jp).
      Amplification of mitochondrial cytochrome c oxidase subunit I gene (COI) using LCO1490 (5′-GGTCAACAAATCATAAAGATATTGG-3′) and HCO2198 (5′-TAAACTTCAGGGTGACCAAAAAATCA-3′) (Folmer et al. 1994) was performed by a thermal cycler, DNA Engine(Bio-Rad), in a 20-µl reaction volume containing 1 µl of template total DNA (approximately 10–100 ng) and 19 µl of premix made with 632-µl deionized water, 80-µl Ex Taq Buffer (TaKara Bio), 64-µl dNTP (each 25 mM), 8-µl each primer (each 10 µM), and 0.1-µl TaKara Ex Taq (5 U/µl,TaKara Bio). Thermal cycling condition comprised an initial denaturation at 95°C for 30 sec; 30 cycles of denaturation at 95°C for 30 sec, annealing at 45°C for 30 sec, and elongation at 72°C for 45°C and a final elongation at 72°C for 7 min.
      The PCR product was purified with the silica method (Boom et al. 1990). Both strands were sequenced with a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) following the manufacturer's protocol, using the same primer set as the initial PCR amplification. Sequencing was performed with ABI Prism 3730 DNA Analyzer (Applied Biosystems). Chromatogram and sequence data were operated with MEGA v5 software (Tamura et al. 2007).

Results
A total of 641 bp of partial sequence of COI was determined from Trachysalambria curvirostris (Stimpson, 1860) (see Appendix).

Taxonomy
Phylum Arthropoda
Class Malacostraca
Order Decapoda Latreille, 1803
Family Penaeidae Rafinesque, 1815
Genus Trachysalambria Burkenroad, 1934
Trachysalambria curvirostris (Stimpson, 1860)
(Figs 1–3)

Material examined: ICHU22100242.



Fig. 1. Trachysalambria curvirostris (Stimpson, 1860), ICHU22100242, entire animal, dorsal view.




Fig. 2. Trachysalambria curvirostris (Stimpson, 1860), ICHU22100242, entire animal, lateral view.




Fig. 3. Trachysalambria curvirostris (Stimpson, 1860), ICHU22100242, carapace, lateral view.



References

Boom, R., Sol, C. J. A., Salimans, M. M. M., Jansen, C. L., Wertheim-van Dillen, P. M. E., and van der Noordaa, J. 1990. Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology 28: 495–503.

Folmer, O., Black, M., Hoeh, W., Lutz, R. and Vrijenhoek, R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299.

Littlewood, D. T. 1994. Molecular phylogenetics ofcupped oysters based on partial 28S rRNA gene sequences. Molecular Phylogenetics and Evolution 3: 221–229.

Stimpson, W. 1857. Prodromus descriptionis animalium evertebratorum, quae in Expeditione ad Oceanum Pacificum Septentrionalem, a Republica Federata missa, Cadwaladaro Ringgold et Johanne Rodgers Ducibus, observavit et descripsit. Pars II. Turbellarieorum Nemertineorum. Proceedings of the Academy of Natural Sciences of Philadelphia 9: 159–165.

Tamura, K., Peterson,D.,Peterson,N.,Stecher,G., Nei, M. and Kumar, S. 2011. MEGA5: Molecullar Evolutionary Genetics Analysis usingmaximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and evolution 28: 2731-2739.




Appendix
Mitochondrial COI partial sequence (641 bp) from ICHU22100242 identidied as Trachysalambria curvirostris (Stimpson, 1860).

TTTATCTTCGGAGCTTGAGCTGGGATAGTGGGTACCGCCTTAAGTTTGATTATTCGAGCTGAACTAGGACAACCAGGTAACCTTATTGGAGATGATCAAATTTACAATGTAGTAGTCACTGCTCATGCCTTTGTAATAATTTTCTTTATAGTTATACCCATAATGATCGGAGGATTTGGAAATTGATTAGTCCCGCTTATATTAGGAGCCCCTGATATAGCATTCCCCCGAATAAATAATATAAGATTCTGGCTTTTACCTCCCTCTCTAACTCTCCTTCTCTCAAGAGGTATAGTCGAAAGTGGGGTAGGAACAGGGTGAACAGTATACCCTCCCTTGGCAAGTGGAATCGCACATGCTGGGGCATCAGTAGATATAGGAATCTTTTCTCTTCATTTAGCAGGAGTCTCATCAATCCTAGGGGCTGTAAATTTTATAACTACAGTAATTAATATACGATCCGCAGGAATAACAATAGACCGTATACCCTTATTTGTTTGATCAGTTTTTATTACTGCCCTTCTCCTACTTCTCTCATTACCAGTATTAGCAGGGGCTATTACGATACTTTTAACTGACCGAAACCTTAATACATCTTTCTTTGACCGCGGCGGGAGGGGGTGACCCCATCCTAACCAAAC