Report of Systematic Zoology Lab Practicum, Volume 4: e03; August, 2013


28S large subunit ribosomal RNA gene partial sequence of Monodonta confusa (Mollusca: Gastropoda: Vetigastropoda: Trochidae)


Mitsuhashi Kei and Katata Satomi

Division of Biology, Department of Biological Sciences, School of Science, Hokkaido University, Sapporo 060-0810, Japan


Material and Methods
A gastropod was obtained at Oshoro Bay, Hokkaido, Japan, about 43°12′N, 140°51′E, on 20 May 2013 by Mitsuhashi Kei and Katata Satomi, photographed by Takumi Onishi, identified by Hiroshi Kajihara as Monodonta confusa Tapparone-Canefri,1874 based on Sasaki (2000) and Donald et al. (2005), and fixed in 99% EtOH. DNA was extracted from the foot using the silica method (Boom et al. 1990) with some modifications. Extracted DNA was dissolved in 30 µl of deionized water and has been preserved at –20°C. Remaining morphological voucher specimen has been deposited at the Hokkaido University Museum under the catalogue number ICHU2110177 (contact: Dr. Hiroshi Kajihara, kazi@mail.sci.hokudai.ac.jp).
      An about 1000-bp fragment of 28S rDNA fragment was amplified by polymerase chain reaction (PCR) using LSU5 (5′-ACCCGCTGAAYTTAAGCA-3′) and LSU3 (5′-TCCTGAGGGAAACTTCGG-3′) (Littlewood et al. 1994). A hot start PCR was performed by a thermal cycler, 2720 Thermal Cycler (Applied Biosystem), in a 20-µl reaction volume containing 1 µl of template total DNA (approximately 10–100 ng) and 19 µl of premix made with 632-µl deionized water, 80-µl Ex Taq Buffer (TaKara Bio), 64-µl dNTP (each 25 mM), 8-µl each primer (each 10 µM), and 0.1-µl TaKara Ex Taq (5 U/µl,TaKara Bio). Thermal cycling condition comprised an initial denaturation at 95°C for 30 sec; 30 cycles of denaturation at 95°C for 30 sec, annealing at 45°C for 30 sec, and elongation at 72°C for 45°C; and a final elongation at 72°C for 7 min. Amplification by the primer pair LCO1490 and HCO2198 (Folmer et al. 1994) was unsuccessful.
      The PCR product was purified with the silica method (Boom et al. 1990). Both strands were sequenced with a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) following the manufacturer's protocol, using the same primer set as used in the initial amplification, as well as the internal primers D2F (5′-CTTTGAAGAGAGAGTTC-3′) (Littlewood et al. 1994) and 28z (5′-CTTGGTCCGTGTTTCAAGAC-3′) (Hillis and Dixon 1991). Sequencing was performed with ABI Prism 3730 DNA Analyzer (Applied Biosystems). Chromatogram and sequence data were operated with MEGA v.5 software (Tamura et al. 2011).


Results
A total of 967 bases of 28S rDNA partial sequence was determined from ICHU2110177, identified as Monodonta confusa (see Appendix).


Taxonomy
Phylum Mollusca
Class Gastropoda
Order Vetigastropoda
Family Trochidae Rafinesque, 1815
Monodonta confusa Tapparone-Canefri, 1874
[Japanese name: ishidatami]
(Figs 1, 2)


Fig. 1. Monodonta confusa Tapparone-Canefri, 1874, ICHU2110177, dorsal veiw of the shell.


Fig. 2. Monodonta confusa Tapparone-Canefri, 1874, ICHU2110177, ventral view of the shell.




References

Boom, R., Sol, C. J. A., Salimans, M. M. M., Jansen, C. L., Wertheim-van Dillen, P. M. E. and van der Noordaa, J. 1990. Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology 28: 495–503.

Donald, K. M., Kennedy, M. and Spencer, H. G. 2005. The phylogeny and taxonomy of austral monodontine topshells (Mollusca: Gastropoda: Trochidae), inferred from DNA sequences. Molecular Phylogenetics and Evolution 37: 474–483.

Folmer, O., Black, M., Hoeh, W., Lutz, R. and Vrijenhoek, R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299.

Hills, D. M. and Dixon, M. T. 1991. Ribosomal DNA: molecular evolution and phylogenetic inference. Quarterly Review of Biology 66: 441–453.

Littlewood, D. T. 1994. Molecular phylogenetics of cupped oysters based on partial 28s rRNA gene sequences. Molecular Phylogenetics and Evolution 3: 221–229.

Sasaki, T. 2000. Trochidae. Pp. 55–83. In: Okutani, T. (Ed.) Marine Mollusks in Japan. Tokai University Press, Tokyo.

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. and Kumar, S. 2011. MEGA5: molecullar evolutionary genetics analysis (MEGA) software version 5.0. Molecular Phylogenetics and Evolution 28: 2731–2739.



Appendix
A 967-base partial sequence of 28S rDNA from ICHU2110177, identidied as Monodonta confusa Tapparone-Canefri, 1874.

TTAGTAACGGCGAGTGAAGCGGGAAAAGCCCAGCACCGAATCCCCTGGTTCTGCGCCAGTGGGAATTGTGGTGTTTGGGACGCCATACGGCGCCGTGTCCCTGTGCCCAAGTCCTTCTGATCGGGGCCTTTCCCAGAGTGGGTGTCAGGCCTTTAGCGGCACGGGACTAGGCGTCCATGAGCGTCCTTGGAGTCGGGTTGTTTGGGAATGCAGCCCTAAGCGGGTGGTAAACTCCATCTAAGGCTAAATACTGGCACGAGTCCGATAGCGAACAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTCTAGAGGTAAGCGGGTGGACCCGTCCAGTCGGCCCTCGGAATTCAGCTTTTGGGACCGCTCGCTGACGCAGCTTTGGGATCCCTCGGACCCGTGCGGTGGCAGATCGAGCTCCTGAGAGTGCACTTTCCGTGTTGGCAGAGCGTCACGACCGGTTCGTCGGCGGTGATAAGGCCTGGGGGAAGGTAGGTCGTGCCTCTTCGGAAGCATGACTGTTATAGACCCCGGGAGATGGCCGCTGTCGGACCGTGGATCGACCTGTCGTATGGCAGTGGGGCTGCCCGCGTGCGTTCGACTGGGGAGGACAGGCTTGCCGTGCTTCCCGACTGCGCTGCGTGGGCGGACTCTGCTATAGCCCGCGACACGTTAGGGTCAGTGACACACGATCGGTAATCCACCCGGCCCGTCTTGAAACACGGACCAAGAAGTCCAACATGTGCGCGAGTCATTGGGTCCTACGAAACCTAAAGGCGTAATGAAGGTGAAGGCAGGTTCGGCCTGCTGAGGTGAGATCCCGGCCCTCGGGCTGGGCGCATCACCGGCCCGTCTGCAAAGGCGGAGCAAGAGCGCACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGAGCAGGATGAAGCCAGAGGAAACTCTG