Report of Systematic Zoology Lab Practicum, Volume 4: e12; August, 2013
A sea anemone sequence from a sea star—28S rDNA partial sequence from Henricia nipponica (Echinodermata: Asteroidea)
Yuko Sugita and Yuko Nakazawa
Division of Biology, Department of Biological Sciences, School of Science, Hokkaido University, Sapporo 060-0810, Japan
Material and Methods
Boom, R., Sol, C. J. A., Salimans, M. M. M., Jansen, C. L., Wertheim-van Dillen, P. M. E., and Van der Noordaa, J. 1990. Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology 28: 495–503. Folmer, O., Black, M., Hoeh, W., Lutz, R., and Vrijenhoek, R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299. Littewood, D. T. 1994. Molecular phylogenetics of cupped oysters based on partial 28S rRNA gene sequences. Molecular Phylogenetics and Evolution 3: 221–229. Hillis, D. M. and Dixon, M. T. 1991. Ribosomal DNA: molecular evolution and phylogenetic inference. Quarterly Review of Biology 66: 411?452. Oguro, C. 1995. Asteroidea. Pp. 513–529. In: Nishimura, S. (Ed.) Guide to Seashore Animals of Japan with Color Pictures and Keys, Vol. II. Hoikusha, Osaka. Tamura, K.,Peterson, D., Peterson, N., Stecher, G., Nei, M., and Kumar, S. 2011. MEGA5: molecullar evolutionary genetics analysis using maximum likelihood, evolutionary distance, and mamaximum parsimony methods. Molecular Biology and Evolution 28: 2731?2739. AAATCTCCGTCGCCTGCGACGGCGAATTGTAGTTTCGAGAAGCACTTTCTAGGTGGACCCGGGGCCGTCCAAGTTGCTTGGAACAGCACGTCATAGAGGGTGACAACCCCGTCTGTGGCGGAACCGGCCGCTGACGATGCGCTTTCGACGAGTCGGGTTGTTTGGGAATGCAGCCCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATACTGGCACGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAACCGTTAAAAGGGAAACGAATGGGGTTAGCAATGCGCTCTGCGAGATTCAGCCGGTGGACGAGCTGGGCGGGCGGTTTGCGGATCTGAATGGACCGCGGCCGTTCGCGTCGGCCCTTCGACCGTCGCACTTCTCGCGAGCGCGCGTCAGCGTCGGTTGGGACTGGGTCTCAAAGGCGCCGGGAAGGTAGGTCTTTCCTCTCGGGGACAGACTGTTATAGACCGGCGTTTTCATGGCTCGGACCTGACCGAGGTGCCGCGGCGTGTGCCTTTTTTGGCTGGGGTCCCGTCGTTCCGGTCGGTCGTCGACTGTGGTGGACTGCGTGCAGTGCGCCGCGACTGCTGCCGGTCGCTTCGGCGGTGACCTCACACCACGCGCCCAGGACGCTGGCGGTCACATGGCCTCATCCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCTTCGAGTGATCGAAACTCCCAGGCGGAATGAAAGTGAAGGTGGCCTCGGCCGCTGAGGTGAGAACCCGCCCCCGCGGTGGGTGCATCATCGACCGACCTATTCTACTCTTAGGAAGGTTTGAGTAAGAGCGCATCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGTATC
A tiny red sea star was obtained among laminarian holdfasts in Oshoro Bay, Hokkaido, Japan, about 43°21′N, 140°85′E, on 3 June 2013 by Yuko Sugita and Yuko Nakazawa, photographed and identified by Hiroshi Kajihara as Henricia nipponica Uchida, 1928 by a reference to Oguro (1995); the specimen was then fixed in 99% EtOH. DNA was extracted from the one of the arms, using the silica method (Boom et al. 1990) with some modifications. Extracted DNA was dissolved in 30 µl of deionized water and has been preserved at –20°C. Remaining morphological voucher specimen has been deposited at the Hokkaido University Museum under the catalogue number ICHU02110895 (contact: Dr. Hiroshi Kajihara, kazi@mail.sci.hokudai.ac.jp).
An about 1.2K-bp fragment of fragment of 28S rRNA gene was amplified by polymerase chain reaction (PCR) using LSU5 (5′-ACCCGCTGAAYTTAAGCA-3′) and LSU3 (5′-TCCTGAGGGAAACTTCGG-3′) (Littlewood 1994). A hot start PCR was performed by a thermal cycler, 2720 Thermal Cycler (Applied Biosystems), in a 20-µl reaction volume containing 1 µl of template total DNA (approximately 10–100 ng) and 19 µl of premix made with 632-µl deionized water, 80-µl Ex Taq Buffer (TaKara Bio), 64-µl dNTP (each 25 mM), 8-µl each primer (each 10 µM), and 0.1-µl TaKara Ex Taq (5 U/µl,TaKara Bio). Thermal cycling condition comprised an initial denaturation at 95°C for 30 sec; 30 cycles of denaturation at 95°C for 30 sec, annealing at 45°C for 30 sec, and elongation at 72°C for 45 sec; and a final elongation at 72°C for 7 min. Amplification of the mitochondrial cytochrome c oxidase subunit I gene by the primer pair LCO1490 and HCO2198 (Folmer et al. 1994) was unsuccesful.
The PCR product was purified with the silica method (Boom et al. 1990). Both strands were sequenced with a BigDyeR Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) following the manufacturer′s protocol, using the primer LSU5, LSU3, D2F (5′-CTTTGAAGAGAGAGTTC-3′) (Littlewood 1994), and 28z (5′-CTTGGTCCGTGTTTCAAGAC-3′) (Hillis and Dixon 1991) set as the initial PCR amplification. Sequencing was performed with ABI Prism 3730 DNA Analyzer (Applied Biosystems). Chromatogram and sequence data were operated with MEGA v5 software (Tamura et al. 2011).
Results
Phylum Echinodermata
Class Asteroidea
Order Spinulosida
Family Echinasteridae
Genus Henricia Gray, 1840
Henricia nipponica Uchida, 1928
[Japanese name: hime-hitode]
Figs 1, 2
A total of 961 bp of 28S rDNA sequence was determined from our specimen (see Appendix). However, this sequence appears to be of Anthopleura fuscoviridis by Uno and Sugawara (2013), because these two sequences match completely. This was probably caused by mixing up the samples, or less likely, the sea star had eaten the sea anemone and we sequenced its gut contents.
Fig. 1. Henricia nipponica Uchida, 1928 (ICHU02110895), aboral view.
Fig. 2. Henricia nipponica Uchida, 1928 (ICHU02110895), oral view.
References
28S rDNA sequence from ICHU02110895 identidied as Henricia sp.