Report of Systematic Zoology Lab Practicum, Volume 4: e13; August, 2013
A partial sequence of the mitochondrial cytochrome c oxidase subunit I gene in the sea snail Chlorostoma lischkei (Mollusca: Gastripoda: Trochidae) from Oshoro Bay, Hokkaido, northern Japan
Akiho Shibata and Kaito Mikuni
Division of Biology, Department of Biological Sciences, School of Science, Hokkaido University, Sapporo 060-0810, Japan
Material and Methods
Boom, R., Sol, C. J. A., Salimans, M. M. M., Jansen, C. L., Wertheim-van Dillen, P. M. E., and van der Noordaa, J. 1990. Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology 28: 495–503. Folmer, O., Black, M., Hoeh, W., Lutz, R. and Vrijenhoek, R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299. Sasaki, T. 2000. Trochidae. Pp. 55–83. In: Okutani, T. (Ed.) Marine Mollusks in Japan. Tokai University Press, Tokyo. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., and Kumar, S. 2011. MEGA5: molecullar evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28: 2731–2739.
CCTGCAGGATCAAAAAAAGAAGTATTAAAATTCCGATCGGTTAAAAGCATTGTAATTGCTCCAGCTAAAACGGGAAGAGATAGCAAAAGCAAAATTGCTGTGATTTTTACTGACCAAACAAATAAAGGCAATCGTTCGAAACTTATACCTTGTCATCGCATGTTAATAACCGTTGTAATGAAATTTACTGCACCTAGAATGGAAGAAATTCCTGCTAAATGCAAAGAAAAAATAGCTAAGTCAACTGATGCACCAGCATGCGCCAGGTTTCTAGCCAAAGGAGGGTAAACTGTTCACCCGGTCCCTGCTCCTCTTTCAACAGCAGCCGAAGACAATAATAAAGTTAGTGCGGGTGGAAGTAACCAAAATCTTATGTTGTTTAACCGAGGAAAAGCTATATCAGGTGCCCCCAACATAAGAGGGATTAATCAATTACCAAATCCACCAATTATTAGAGGCATTACTAAAAAGAAAATTATAACAAAAGCATGTGCAGTAACAATTACATTATAAAGTTGATCGTCTCCTAATAATGCTCCTGGCTGACCTAGCTCAGCTCGAATTAATAGTCTTAAGGCTGTCCCAACTAGCCCA
A sea snail was obtained in the intertidal zone of Oshoro Bay, Hokkaido, Japan, about 43°21′N, 140°85′E, on 3 June 2013 by Akiho Shibata and Kaito Mikuni, photographed and identified by Hiroshi Kajihara as Chlorotoma lischkei (Tapparone-Canefri, 1874) by a reference to Sasaki (2000), and fixed in 99% EtOH. Total DNA was extracted from the foot using the silica method (Boom et al. 1990) with some modifications. Extracted DNA was dissolved in 30 µl of deionized water and has been preserved at –20°C. Remaining morphological voucher specimen has been deposited at the Hokkaido University Museum under the catalogue number ICHU2111034 (contact: Dr. Hiroshi Kajihara, kazi@mail.sci.hokudai.ac.jp).
An about 600-bp fragment of fragment of mitochondrial cytochrome c oxidase subunit I gene (COI) was amplified by polymerase chain reaction (PCR) using LCO1490 (5′-GGTCAACAAATCATAAAGATATTGG-3′) and LSU3 (5′-TAAACTTCAGGGTGACCAAAAAATCA-3′) (Folmer et al. 1994). A hot start PCR was performed by a thermal cycler, 2720 Thermal Cycler (Applied Biosystems), in a 20-µl reaction volume containing 1 µl of template total DNA (approximately 10–100 ng) and 19 µl of premix made with 632-µl deionized water, 80-µl Ex Taq Buffer (TaKara Bio), 64-µl dNTP (each 25 mM), 8-µl each primer (each 10 µM), and 0.1-µl TaKara Ex Taq (5 U/µl,TaKara Bio). Thermal cycling condition comprised an initial denaturation at 95°C for 30 sec; 30 cycles of denaturation at 95°C for 30 sec, annealing at 45°C for 30 sec, and elongation at 72°C for 45°C and a final elongation at 72°C for 7 min.
The PCR product was purified with the silica method (Boom et al. 1990). Both strands were sequenced with a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) following the manufacturer's protocol, using the same primer set as the initial PCR amplification. Sequencing was performed with ABI Prism 3730 DNA Analyzer (Applied Biosystems). Chromatogram and sequence data were operated with MEGA v5 software (Tamura et al. 2011).
Results
After eliminating the primer sites, a total of 658 bp of COI sequence was determined from ICHU2111034, identified as Chlorostoma lischkei (Tapparone-Canefri, 1874) (see Appendix).
Taxonomy
Phylum Mollusca
Class Gastropoda
Subclass Prosobranchia
Order Vetigastropoda
Supperfamily Trochoidea
Family Trochidae Stephen and Edmonds, 1972
Genus Chlorostoma Leukart, 1828
Chlorostoma lischkei (Tapparone-Canefri, 1874)
[Japanese name: kubogai]
(Figs 1, 2)
Fig. 1. Chrolostoma lischkei (Tapparone-Canefri, 1874), ICHU2111034, photograph taken in life from ventral side of the shell, showing the characteristic greenish callus covering the umbilicus.
Fig. 2. Chlorostoma lischkei (Tapparone-Canefri, 1874), ICHU2111034.
, ICHU2111034, dorsal view of the shell.
References
COI sequence from ICHU2111034 identidied as Chlorostoma lischkei (Tapparone-Canefri, 1874).