Report of Systematic Zoology Lab Practicum, Volume 4: e18; August, 2013


28S large subunit ribosomal RNA gene partial sequence of Anthopleura fuscoviridis (Cnidaria: Hexacorallia: Actiniaria) from Oshoro Bay, Hokkaido, Japan


Reo Uno and Shino Sugawara

Division of Biology, Department of Biological Sciences, School of Science, Hokkaido University, Sapporo 060-0810, Japan


Material and Methods
A sea anemone with green warts was obtained in Oshoro Bay, Hokkaido, Japan, on 12 June 2013 by Reo Uno and Shino Sugawara, photographed and identified by Hiroshi Kajihara as Anthopleura fuscoviridis Carlgren, 1949 by a reference to Uchida (1992), and fixed in 99% EtOH. DNA was extracted from the posterior half of the body using the silica method (Boom et al. 1990) with some modifications. Extracted DNA was dissolved in 30 µl of deionized water and has been preserved at –20°C. Remaining morphological voucher specimen has been deposited at the Hokkaido University Museum under the catalogue number ICHU22090184 (contact: Dr. Hiroshi Kajihara, kazi@mail.sci.hokudai.ac.jp).
      An about 1500-bp fragment of 28S rDNA fragment was amplified by polymerase chain reaction (PCR) using LSU5 (5′-ACCCGCTGAAYTTAAGCA-3′) and LSU3 (5′-TCCTGAGGGAAACTTCGG-3′) (Littlewood et al. 1994). A hot start PCR was performed by a thermal cycler,2720 thermal cycler (Applied Biosystems), in a 20-µl reaction volume containing 1 µl of template total DNA (approximately 10–100 ng) and 19 µl of premix made with 632-µl deionized water, 80-µl Ex Taq Buffer (TaKara Bio), 64-µl dNTP (each 25 mM), 8-µl each primer (each 10 µM), and 0.1-µl TaKara Ex Taq (5 U/µl,TaKara Bio). Thermal cycling condition comprised an initial denaturation at 95°C for 30 sec; 30 cycles of denaturation at 95°C for 30 sec, annealing at 45°C for 30 sec, and elongation at 72°C for 45 sec; and a final elongation at 72°C for 7 min. Prior to this, an attempt had been failed to PCR-amplify the mitochondrial cytochrome c oxidase subunit I gene using LCO1490 (5′-GGTCAACAAATCATAAAGATATTGG-3′) and HCO2198 (5′-TAAACTTCAGGGTGACCAAAAAATCA-3′) (Folmer et al. 1994).
      The PCR product was purified with the silica method (Boom et al. 1990). Both strands were sequenced with a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) following the manufacturer's protocol, using the same primer set and new primer set, D2F (5′-CTTTGAAGAGAGAGTTC-3′) (Littlewood et al. 1994) and 28z (5′-CTTGGTCCGTGTTTCAAGAC-3′) (Hillis and Dixon et al. 1991) as the initial PCR amplification. Sequencing was performed with ABI Prism 3730 DNA Analyzer (Applied Biosystems). Chromatogram and sequence data were operated with MEGA v.5 software (Tamura et al. 2011).


Results
Phylum Cnidaria
Class Anthozoa
Subclass Hexacorallia
Order Actiniaria
Family Actiniidae Rafinesque, 1815
Anthopleura fuscoviridis Carlgren, 1949
[Japanese name: midori-isoginchaku]
(Figs 1, 2)

A total of 1054 bases of 28S rDNA partial sequence was determined from ICHU22090184, identified as Anthopleura fuscoviridis Carlgren, 1949 (see Appendix).



Fig. 1. Anthopleura cf. midori (Carlgren, 1949), ICHU22090184, entire animal.


Fig. 2. Anthopleura cf. midori (Carlgren, 1949), ICHU22090184, enlargement of oral disc.



References

Boom, R., Sol, C. J. A., Salimans, M. M. M., Jansen, C. L., Wertheim-van Dillen, P. M. E., and van der Noordaa, J. 1990. Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology 28: 495–503.

Folmer, O., Black, M., Hoeh, W., Lutz, R. and Vrijenhoek, R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299.

Littlewood, D. T. 1994. Molecular phylogenetics of cupped oysters based on partial 28s rRNA gene sequences. Molecular Phylogenetics and Evolution 3 221-229.

Hills, D. M. and Dixon, M.T. 1991. Ribosomal DNA: molecular evolution and phylogenetic inference. Quarterly Review of Biology 66 441-453

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., and Kumar, S. 2011. MEGA5: Molecullar Evolutionary Genetics Analysis (MEGA) software version 5.0. Molecular Phylogenetics and Evolution 28: 2731-2739.

Uchida, H. 1992. Hexacorallia. Pp. 118–167. In: Nishimura, S. (Ed.) Guide to Seashore Animals of Japan with Color Pictures and Keys, Vol. I. Hoikusha, Osaka.



Appendix
A 1054-base partial sequence of 28S rDNA sequence from ICHU22090184, identidied as Anthopleura fuscoviridis Carlgren, 1949 collected in Oshoro Bay, Hokkaido, northern Japan.

CCTAGTAATGGCGAATGAAGCGGGAACAGCTCAAATTTGAAATCTCCGTCGCCTGCGACGGCGAATTGTAGTTTCGAGAAGCACTTTCTAGGTGGACCCGGGGCCGTCCAAGTTGCTTGGAACAGCACGTCATAGAGGGTGACAACCCCGTCTGTGGCGGAACCGGCCGCTGACGATGCGCTTTCGACGAGTCGGGTTGTTTGGGAATGCAGCCCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATACTGGCACGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAACCGTTAAAAGGGAAACGAATGGGGTTAGCAATGCGCTCTGCGAGATTCAGCCGGTGGACGAGCTGGGCGGGCGGTTTGCGGATCTGAATGGACCGCGGCCGTTCGCGTCGGCCCTTCGACCGTCGCACTTCTCGCGAGCGCGCGTCAGCGTCGGTTGGGACTGGGTCTCAAAGGCGCCGGGAAGGTAGGTCTTTCCTCTCGGGGACAGACTGTTATAGACCGGCGTTTTCATGGCTCGGACCTGACCGAGGTGCCGCGGCGTGTGCCTTTTTTGGCTGGGGTCCCGTCGTTCCGGTCGGTCGTCGACTGTGGTGGACTGCGTGCAGTGCGCCGCGACTGCTGCCGGTCGCTTCGGCGGTGACCTCACACCACGCGCCCAGGACGCTGGCGGTCACATGGCCTCATCCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCTTCGAGTGATCGAAACTCCCAGGCGGAATGAAAGTGAAGGTGGCCTCGGCCGCTGAGGTGAGAACCCGCCCCCGCGGTGGGTGCATCATCGACCGACCTATTCTACTCTTAGGAAGGTTTGAGTAAGAGCGCATCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAAA