Report of Systematic Zoology Lab Practicum, Volume 5: e04; August, 2014


16S ribosomal RNA gene partial sequence of Vayssierea elegans (Gastropoda: Nudibranchia) from Oshoro Bay, Hokkaido, Japan


Mieko Nakatuka and Akira Yamashita

Division of Biology, Department of Biological Sciences, School of Science, Hokkaido University, Sapporo 060-0810, Japan



Material and Methods
An orange chromodorid nudibranch was obtained at Oshoro Bay, Hokkaido, Japan, about 43°12′N, 140°51′E, on 19 May 2014 by Mieko Nakatuka and AKira Yamashita. It was identified by Hiroshi Kajihara as Chromodoris elegans (Baba, 1930), then photographed and fixed in 99% EtOH by Takumi Okanishi. Total DNA was extracted from the entire animal, using the silica method (Boom et al. 1990) with some modifications. Extracted DNA was dissolved in 30 µl of deionized water and has been preserved at –20°C.
      An about 400-bp fragment of the mitochondrial 16S rRNA gene was amplified by polymerase chain reaction (PCR) using ar-L (5′-CGCCTGTTTATCAAAAACAT-3′) and br-H (5′-CCGGTCTGAACTCAGATCACGT-3′) (Palumbi et al. 1991). A hot start PCR was performed by a thermal cycler, 2720 Thermal Cycler (Applied Biosystems), in a 20-µl reaction volume containing 1 µl of template total DNA (approximately 10–100 ng) and 19 µl of premix made with 632-µl deionized water, 80-µl Ex Taq Buffer (TaKara Bio), 64-µl dNTP (each 25 mM), 8-µl each primer (each 10 µM), and 0.1-µl TaKara Ex Taq (5 U/µl,TaKara Bio). Thermal cycling condition comprised an initial denaturation at 95°C for 30 sec; 30 cycles of denaturation at 95°C for 30 sec, annealing at 45°C for 30 sec, and elongation at 72°C for 45 sec; and a final elongation at 72°C for 7 min. Prior to this, an attempt to amplify the mitochondrial cytochrome c oxidase subunit I gene (COI) using LCO1490 (5′-GGTCAACAAATCATAAAGATATTGG-3′) and HCO2198 (5′-TAAACTTCAGGGTGACCAAAAAATCA-3′) (Folmer et al. 1994) had been unsuccessful.
      The PCR product was purified with the silica method (Boom et al. 1990). Both strands were sequenced with a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) following the manufacturer's protocol, using the same primer set as the initial PCR amplification and an internal primer set D2F(5′-CTTGAAGAGAGAGTTC-3′)(Littlewood. 1994) and 28z(5′-CTTGGTCCGTGTTCAAGAC-3′)(Hillis and Cixon.1991) . Sequencing was performed with ABI Prism 3730 DNA Analyzer (Applied Biosystems). Chromatogram and sequence data were operated with MEGA v5 software (Tamura et al. 2011).

Results
Phylum Mollusca
Class Gastropoda
Infraclass Opisthobranchia
Oder Nudibranchia
Infraorder Doridacea
Family Okadaiidae
Genus Vayssierea Risbec, 1928
Vayssierea elegans (Baba, 1930)
[Japanese naem: Okada-umiushi]

(Fig. 1)


A total of 437 bp of the 16S rRNA gene sequence was determined from Vayssierea elegans (see Appendix). As of writing, there was no entry of Vayssierea in GenBank that was comparable with our sequence.


Fig. 1. Vayssierea elegans (ICHU2120016), dorsal view, collected in the intertidal zone of Oshoro Bay, Hokkaido, Japan.



References

Boom, R., Sol., C. J. A., Salimans, M. M. M., Jansen, C. L., Wertheim-van Dillen, P. M. E., and van der Noordaa, J. 1990. Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology28: 495–503.

Folmer, O., Black, M., Hoeh, W., Lutz, R. and Vrijenhoek, R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299.

Palumbi, S., Martin, A., Romano, S., McMillan, W. O., Stice, L., Grabowski, G. 1991. The Simple Fools Guide to PCR, Ver. 2. Department of Zoology and Kewalo Marine Laboratory, University of Hawaii, Honolulu, 45 pp.

Tamura, K., Peterson, D., Pererson, N., Stecher, G., Nei, M., and Kumar, S.2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28: 2731–2739.




Appendix
A 437-bp partial sequence of the mitochondrial 16S rRNA gene determined from ICHU2120016, identidied as Vayssierea elegans (Baba, 1930), collected in Oshoro Bay, Hokkaido, Japan.

AGCTTTAAGAAGTATTTTTAAGGTTTTACCTGCTCAATGTTAGTAATTAATAGCCGCGGTACATTGACCGTGCAAAGGTAGCATAATTAATTGGTTTTTAATTGAGGCCTTGTATGAATGGAGTTACGGATTTTAACTGTCTTTAATTTATTTTTTTGAAATTACTTTTTTGGTGAAAAAGCCTTTTTTAGCAAAAAGACGAGAAGACCCTAAGAATTTTGTTTAATACATTGATGTTTCATTGTTAAGATTTTGTTGGGGCAACATAAAAGCAATTTTAATCTTTTAAAGAAAAATTTTTTACTTTTTTAAGGGTTGTTAAATTACCTTAGGGATAACAGCATAATTTTATTAATAAGTTTGTGACCTCGATGTTGGATTGGGAACTTGAAAGGTTAGTAACTTTTCAATGATGTTCTGTTCGAACAAAATTTCCC