Report of Systematic Zoology Lab Practicum, Volume 5: e13; August, 2014
Nucleus-encoded 28S large subunit ribosomal RNA gene partial sequence of Phascolosoma scolops (Annelida: Sipuncula: Phascolosomatidae) from Oshoro Bay, Hokkaido, Japan
Haruka Takano and Kai Otsuka
Division of Biology, Department of Biological Sciences, School of Science, Hokkaido University, Sapporo 060-0810, Japan
Material and Methods
Boom, R., Sol, C. J. A., Salimans, M. M. M., Jansen, C. L., Wertheim-van Dillen, P. M. E., and van der Noordaa, J. 1990. Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology 28: 495–503. Palumbi, S., Martin, A., Romano, S., McMillan, W. O., Stice, L. & Grabowski, G. 1991. The Simple Fools Guide to PCR. Version 2.0. Department of Zoology and Kewalo Marine Laboratory, University of Hawaii, Honolulu, 45 pp. Littlewood, D. T. 1994. Molecular phylogenetics of cupped oysters based on partial 28s rRNA gene sequences. Molecular Phylogenetics and Evolution 3 221–229. Whiting, M. F., Carpenter, J. M., Wheeler, Q. D. & Wheeler, W. C. 1997. The Strepsiptera problem: phylogeny of the holometabolous insect orders inferred from 18S and 28S ribosomal DNA sequences and morphology. Systematic Biology 46: 1–68. Tamura K., Peterson, N., Stecher, G., Nei, M., and Kumer, S. 2011. MEGA5: molecullar evolutionary genetics analysis using maximum likelihood, evolutionaly distance, and maximum parsimony methods. Molecular Biology and Evolution 28: 2731–2739.
ACTAGACGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTTTGACGATCGATTTGCACGTCAGAATCGCTACGGTCCTCCACCAGAGTTTCCTCTGGCTTCAACCTGCTCAGGCATAGTTCACCATCTTTCGGGTCCCAACGTGTACGCTCTTGCGCCGCCTCCCGGAACTCCTGCCGGCCGAGACGGGCCGGTGGTGCGCCCGGCCCCGAAGGCCGGGATCCCACCTCCAAGCTGCGAGAGCAGCCCTTCACTTTCATTCCGCCTGTGGGTTTCGTAGAGCCCAATGACTCGCGCACATGTTAGACTCCTTGGTCCGTGTTTCAAGACGGGTC
A peanut worm was obtained from a tide pool in Oshoro Bay, Hokkaido, Japan, about 43°21′N, 140°85′E, on 2 June 2014 by Haruka Takano and Kai Otsuka, photographed and fixed in 99% EtOH; it was identified by Hiroshi Kajihara as Phascolosoma scolops (Selenka and De Man, 1883). DNA was extracted from the posterior half of the body using the silica method (Boom et al. 1990) with some modifications. Extracted DNA was dissolved in 30 µl of deionized water and has been preserved at –20°C. Remaining morphological voucher specimen has been deposited at the Hokkaido University Museum under the catalogue number ICHU2121028 (contact: Dr. Hiroshi Kajihara, kazi@mail.sci.hokudai.ac.jp).
An about 1000-bp fragment of 28S rDNA fragment was amplified by polymerase chain reaction (PCR) using LSU5 (5′-ACCCGCTGAAYTTAAGCA-3′) (Littlewood 1994) and a (5′- GACCCGTCTTGAAACACGGA-3′) (Whiting et al. 1997). A hot start PCR was performed by a thermal cycler, 2720 Thermal Cycler (Applied Biosystem), in a 20-µl reaction volume containing 1 µl of template total DNA (approximately 10–100 ng) and 19 µl of premix made with 632-µl deionized water, 80-µl Ex Taq Buffer (TaKara Bio), 64-µl dNTP (each 25 mM), 8-µl each primer (each 10 µM), and 0.1-µl TaKara Ex Taq (5 U/µl,TaKara Bio). Thermal cycling condition comprised an initial denaturation at 95°C for 30 sec; 30 cycles of denaturation at 95°C for 30 sec, annealing at 45°C for 30 sec, and elongation at 72°C for 45°C and a final elongation at 72°C for 7 min.
The PCR product was purified with the silica method (Boom et al. 1990). Both strands were sequenced with a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) following the manufacturer's protocol, using the same primer set and new primer set, D2F (5′-CTTTGAAGAGAGAGTTC-3′) (Littlewood et al. 1994) and 28z (5′-CTTGGTCCGTGTTTCAAGAC-3′) (Hillis and Dixon et al. 1991) as the initial PCR amplification. Sequencing was performed with ABI Prism 3730 DNA Analyzer (Applied Biosystems). Chromatogram and sequence data were operated with MEGA v.5 software (Tamura et al. 2011).
Results
Phylum Annelida
Taxon Sipuncula
Family Phascolosomatidae
Genus Phascolosoma
Phascolosoma scolops (Selenka and De Man, 1883)
[Japanese name: samehada-hoshimushi]
(Fig. 1)
The chromatograms generated by the sequencer were mostly dirty; due to the low quality, only 334 bases of 28S rDNA partial sequence was reliably determined (see Appendix).
Fig. 1. Phascolosoma scolops (Selenka and De Man, 1883), ICHU02121028, soaked in 99% ethanol.
References
Appendix
A 334-base partial sequence of 28S rDNA sequence from ICHU02121028, identidied as Phascolosoma scolops (Selenka & de Man, 1883).