Report of Systematic Zoology Lab Practicum, Volume 5: e16; August, 2014


Partial sequence of the nucleus-encoded 28S rRNA gene of the comb jelly Beroe cucumis (Ctenophora: Nuda) from Oshoro Bay, Hokkaido, northern Japan


Yoko Uchida and Takaaki Terada

Division of Biology, Department of Biological Sciences, School of Science, Hokkaido University, Sapporo 060-0810, Japan


Material and Methods
A comb jelly was obtained at Oshoro Bay, Hokkaido, Japan, about 43°12′N, 140°51′E on 9 June 2014 by Yoko Uchida and Takaaki Terada; it was identified by Hiroshi Kajihara as Beroe cucumis (Fabricius, 1780), then photographed and fixed in 99% EtOH by Takumi Onishi. Total DNA was extracted from the posterior half of the body using the silica method (Boom et al. 1990) with some modifications. Extracted DNA was dissolved in 30 µl of deionized water and has been preserved at –20°C. Remaining morphological voucher specimen has been deposited at the Hokkaido University Museum under the catalogue number ICHU2122042 (contact: Dr. Hiroshi kajihara, kazi@mail.sci.hokudai.ac.jp).
      Hot start PCRs were performed by a thermal cycler, iCycler (Bio-Rad), in a 20-µl reaction volume containing 1 µl of template total DNA (approximately 10–100 ng) and 19 µl of premix made with 632-µl deionized water, 80-µl Ex Taq Buffer (TaKara Bio), 64-µl dNTP (each 25 mM), 8-µl each primer (each 10 µM), and 0.1-µl TaKara Ex Taq (5 U/µl, TaKaRa Bio). Amplification of the mitochondrial cytochrome c oxidase subunit I (COI) gene using LCO1490 (5′-GGTCAACAAATCATAAAGATATTGG-3′) and HCO2198 (5′-TAAACTTCAGGGTGACCAAAAAATCA-3′) (Folmer et al. 1994) was unsuccessful. An about 1.2K-bp fragment of the 28S rRNA gene was amplified by using the primer pair LSU5 (ACCCGCTGAAYTTAAGCA) and LSU3 (TCCTGAGGGAAACTTCGG) (Littlewood. 1994). The thermal cycling condition comprised an initial denaturation at 95°C for 30 sec; 30 cycles of denaturation at 95°C for 30 sec, annealing at 45°C for 30 sec, and elongation at 72°C for 45 sec (COI) or 3 min (28S); and a final elongation at 72°C for 7 min.
      The PCR product was purified with the silica method (Boom et al.1990). Both strands were sequenced with a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) following the manufactur's protocol, using the same primer set as the initial PCR amplification. Sequencing was performed with ABI Prism 3730 DNA Analyzer (Applied Biosystems). Chromatogram and sequence data were operated with MEGA v5 software (Tamura et al. 2011)


Results
Phylum Ctenophora
Class Nuda
Order Beroida
Family Beroidae Eschscholtz, 1825
Genus Beroe Browne, 1756
Beroe cucumis (Fabricius, 1780)
[Japanese name: urikurage]

(Figs 1,2)

A 453-bp partical sequence of the 28S rRNA gene was determind from Beroe cucumis (see Appendix). A nucleotide BLAST search (Altschul et al. 1997) at the NCBI website (https://blast.ncbi.nlm.nih.gov/) showed that our sequence from Oshoro matched AY026369 with high similarity (100% in query coverage; E value = 1e-168; 99% identity); the latter is a sequence of a specimen identified as B. cucumis from unknown locality (probably west coast of the USA) by Medina (et al. 2001).



Fig. 1. Beroe cucumis (Fabricius, 1780), ICHU02122042, photograph taken in life.


Fig. 2. Beroe cucumis (Fabricius, 1780), ICHU02122042, enlarged view of comb.



References

Boom, R., Sol, C. J. A., Salimans, M. M. M., Jansen, C. L., Wertheim-van Dillen, P. M. E., and van der Noordaa, J. 1990. Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology 28:,495–503.

Folmer, O., Black, M., Hoeh, W., Lutz, R. and Vrijenhoek, R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299.

Littlewood, D. T. 1994. Molecular phylogenetics of cupped oysters based on partial 28S rRNA gene sequences. Molecular Phylogenetics and Evolution 3:221–229.

Medina, M., Collins, A. G., Silberman, J. D., and Sogin, M. L. 2001. Evaluating hypotheses of basal animal phylogeny using complete sequences of large and small subunit rRNA. Proceedings of the National Academy of Science, U.S.A 98: 9707–9712.

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., and Kumar, S. 2011. MEGA5: molecular evolutionary dgenetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28:2731–2739.

Appendix
28S rRNA sequence from ICHU02122042 identidied as Beroe cucumis (Fabricius, 1780).

ACTTCGGAGGGAACCAGCTACTAGATGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTTTGACGATCGATTTGCACGTCAGAACCGCTACGAGCCTCCACCAGGGTTTCCCCTGGCTTCGCCCTACTCAGGCATAGTTCACCATCTTTCGGGTCCCGACGGGTACGCTCTTACTCGGACAAGTCCACATGTGGAATTTGCCGGTCGATGATGCGCCTCGCAGAAGCGAGGATCTCACCTAAGTTGGCCGAACCAACCTTCACTTTCGTTGCGCCCTAGAGTTTGCCACTCTGAGACTCGCGCACACGTCAGACTCCTTGGTCCGTGTTTCAAGACGGGTCAAGGAGTCTGACGTGTGCGCGAGTCTCGAGTGGCAAACTCTAGGGCGCAACGAAAGTGAAGGTTGGTTGGCCAACTTAGGTGAGATCCTCGCTTCTGCGAGGCGCATCATCG