Report of Systematic Zoology Lab Practicum, Volume 5: e19; August, 2014


Partial sequence of the mitochondrial cytochrome c oxidase subunit I gene of Phascolosoma agassizii (Annelida: Sipuncula) from Oshoro Bay, Hokkaido, Japan


Kaori Maehata

Division of Biology, Department of Biological Sciences, School of Science, Hokkaido University, Sapporo 060-0810, Japan


Material and Methods
A sipunculid specimen was obtained from among laminarian holdfasts in Oshoro Bay, Hokkaido, Japan, about 43°12′N, 140°51′E, on 13 June 2014 by Kaori Maehata, then photographed and fixed in 99% EtOH by Takumi Onishi; the specimen was identified by Hiroshi Kajihara as Phascolosoma agassizii Keferstein, 1866 based on Nishikawa (1992). Total DNA was extracted from the posterior half of the body using the silica method (Boom et al. 1990) with some modifications. Extracted DNA was dissolved in 30 µl of deionized water and has been preserved at –20°C. Remaining morphological voucher specimen has been deposited at the Hokkaido University Museum under the catalogue number ICHU2122055 (contact: Dr. Hiroshi Kajihara, kazi@mail.sci.hokudai.ac.jp).
      An about 600-bp fragment of the mitochondrial cytochrome c oxidase subunit I (COI) gene was amplified by polymerase chain reaction (PCR) using the primer pair LCO1490 (5′-GGTCAACAAATCATAAAGATATTGG-3′) and HCO2198 (5′-TAAACTTCAGGGTGACCAAAAAATCA-3′) (Folmer et al. 1994). A hot start PCR was performed by a thermal cycler, 2720 Thermal Cycler (Applied Biosystems), in a 20-µl reaction volume containing 1 µl of template total DNA (approximately 10–100 ng) and 19 µl of premix made with 632-µl deionized water, 80-µl Ex Taq Buffer (TaKara Bio), 64-µl dNTP (each 25 mM), 8-µl each primer (each 10 µM), and 0.1-µl TaKara Ex Taq (5 U/µl,TaKara Bio). Thermal cycling condition comprised an initial denaturation at 95°C for 30 sec; 30 cycles of denaturation at 95°C for 30 sec, annealing at 45°C for 30 sec, and elongation at 72°C for 45°C and a final elongation at 72°C for 7 min.
      The PCR products were purified with the silica method (Boom et al. 1990). Both strands were sequenced with a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) following the manufacturer's protocol, using the same primer set as the initial PCR amplification. Sequencing was performed with ABI Prism 3730 DNA Analyzer (Applied Biosystems). Chromatogram and sequence data were operated with MEGA v.5 software (Tamura et al. 2011).


Results
Phylum Annelida
Taxon Sipuncula
Family Phascolosomatidae Stephen and Edmonds, 1972
Genus Phascolosoma Leukart, 1828
Phascolosoma agassizii Keferstein, 1866
[Japanese name: yamato-samehada-hoshimushi]

(Fig. 1)


The mitochondrion-encoded COI gene sequence was determined for a 658-bp strech from ICHU2122055, identified as Phascolosoma agassizii (see Appendix). A nucleotide BLAST search (Altschul et al. 1997) at the NCBI website (https://blast.ncbi.nlm.nih.gov/) with my COI sequence resulted in that it completely matched (100% query coverage and identity; E value = 0.0) KM226361 (Johnson et al. unpublished) and JQ904311 (Schulze et al. 2012), both from the Sea of Japan in the Russian Far East.



Fig. 1. Phascolosoma agassizii Keferstein, 1866 (ICHU2122055) from Oshoro Bay, photograph taken in life; the extruded proboscis completely lacks dark markings.




References

Altschul, S. F., Madden, T. L., Schäffer, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D. J. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 25: 3389–3402.

Boom, R., Sol, C. J. A., Salimans, M. M. M., Jansen, C. L., Wertheim-van Dillen, P. M. E., and van der Noordaa, J. 1990. Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology 28: 495–503.

Folmer, O., Black, M., Hoeh, W., Lutz, R. and Vrijenhoek, R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299.

Nishikawa, T. 1992. Sipuncula. Pp. 299–305. In: Nishimura, S. (Ed.) Guide to Seashore Animals of Japan with Color Pictures and Keys. Vol. I. Hoikusha, Osaka.

Schulze, A., Maiorova, A., Timm, L. E., and Rice, M. E. 2012. Sipunculan larvae and "cosmopolitan" species. Integrative and Comparative Biology 52(4): 497–510.

Tamura, K., Peterson, N., Stecher, G., Nei, M., and Kumar, S. 2011. MEGA5: Molecullar Evolutionary Genetics Analysis (MEGA) softwre version 5.0. Molecular Phylogenetics and Evolution 24: 1596–1599.

Appendix
A 658-bp partial sequence of the COI gene from ICHU2122055 identidied as Phascolosoma agassizii Keferstein, 1866 collected in Oshoro Bay, Hokkaido, northern Japan.

AACCTTATATTTTATTTTAGGAATCTGATCAGGCCTCATGGGAACTTCAATAAGACTTCTTATTCGAGCGGAACTTGGCCAGCCTGGATCTTTATTAGGTAGAGACCAGCTCTATAATGTTATTGTTACAGCTCATGCATTTTTAATAATTTTCTTTTTAGTGATACCTGTTCTAATTGGAGGATTTGGAAACTGGTTAATTCCACTAATAATTGGAGCTCCAGATATAGCTTTTCCTCGTTTAAATAATCTTAGTTTTTGATTATTGCCCCCTGCTCTATGTCTCCTACTAGCATCTAGGGCCGTAGAAAAAGGAGTTGGTACTGGCTGAACAGTTTATCCTCCTTTATCTGGTGCTCTAGCTCATGCAGGCGCATCAGTAGACTTAGCTATCTTCTCTCTTCATTTAGCCGGAGTAAGATCAATTTTAGGTGCATTAAATTTTATTTCTACAGTAACAAATATACGACCTAGAATATTTTCTTGGGAGCGAGTACCTTTATTTGTATGGGCTGCCTTTATTACAGTTATCCTTTTACTTCTAGCTCTCCCTGTACTAGCGGGAGCTATTACAATATTACTAACAGATCGAAATTTAAATACTGCCTTTTTTGACCCAGGAGGGGGCGGAGACCCTATTCTTTTCAGACATCTATTT