Report of Systematic Zoology Lab Practicum, Volume 6: e02; August, 2015


Partial sequence of the mitochondrial 16S ribosomal RNA gene of an unidentified polychaete in the family Nereididae (Annelida) from Oshoro Bay, Hokkaido, northern Japan


Taketo Umekawa and Kouga Kawano

Division of Biology, Department of Biological Sciences, School of Science, Hokkaido University, Sapporo 060-0810, Japan


Material and Methods
A nereidid polychaete was collected from among holdfasts of brown alagae (Undaria pinnatifida (Harvey) Suringar and Saccharina longissima (Miyabe) Yotsukura et Druehl) in the intertidal zone of Oshoro Bay, Hokkaido, Japan, about 43°12&min;N, 140°51&min;E, on 27 April 2015 by Taketo Umekawa and Kouga Kawano. It was photographed alive and fixed in 99% EtOH by Shinri Tomioka. Total DNA was extracted from the central region using the silica method (Boom et al. 1990) with some modifications. Extracted DNA was dissolved in 30 µl of deionized water and has been preserved at –20°C. Remaining morphological voucher specimen has been deposited at the Hokkaido University Museum under the catalogue number ICHU1130007 (contact: Dr. Hiroshi Kajihara, kazi@mail.sci.hokudai.ac.jp).
      PCR amplification was attempted with the primer pairs LoboF1 (5′-KBTCHACAAAYCAYAARGAYATHGG-3′) and LoboR1 (5′-TGTTTYTTYGGWCAYCCWGARGTTTA-3′) (Lobo et al. 2013) for the mitochondrial cytochrome c oxidase subunit I gene (COI) and 16S ar-L (5′-CGCCTGTTTATCAAAAACAT-3′) and br-H (5′-CCGGTCTGAACTCAGATCACGT-3′) (Palumbi et al. 1991) for the 16S rRNA gene. PCR products were visualized by electrophoresis in 1% agarose gel. Of the two gene markers that were attempted, only 16S rRNA gene was confirmed to be successfully amplified. The PCR was performed by a thermal cycler, 2720 Thermal Cycler (Applied Biosystems), in a 20-µl reaction volume containing 1 µl of template total DNA (approximately 10–100 ng) and 19 µl of premix made with 632-µl deionized water, 80-µl Ex Taq Buffer (TaKara Bio), 64-µl dNTP (each 25 mM), 8-µl each primer (each 10 µM), and 0.1-µl TaKara Ex Taq (5 U/µl,TaKara Bio). Thermal cycling condition comprised an initial denaturation at 95°C for 30 sec; 30 cycles of denaturation at 95°C for 30 sec, annealing at 45°C for 30 sec, and elongation at 72°C for 45°C and a final elongation at 72°C for 7 min.
      The PCR products of the 16S rRNA gene were purified with the silica method (Boom et al. 1990). Both strands were sequenced with a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) following the manufacturer's protocol, using the same primer set as the initial PCR amplification. Sequencing was performed with ABI Prism 3730 DNA Analyzer (Applied Biosystems). Chromatogram and sequence data were operated with MEGA v5.2 software (Tamura et al. 2011).


Results
Phylum Annelida
Class Polychaeta
Order Phyllodocida
Family Nereididae Blainville, 1818
Nereididae gen. et sp. indet.
(Fig. 1)

A 484-bp partial sequence of the mitochondrial 16S rRNA gene was determined from ICHU1130007, an unidentified species in the family Nereididae (see Appendix). A nucleotide BLAST search (Altschul et al. 1997) at the NCBI website (https://blast.ncbi.nlm.nih.gov/) showed that our sequence was most similar to AY340470 (91% similarity; E value = 6e–177; 95% in query coverage), a 16S rRNA partial sequence of a polyclad flatworm identified as Nereis pelagica Linnaeus, 1758 (Rousset et al. 2007).



Fig. 1. ICHU1130007, an unidentified nereidid polychaete collected in Oshoro Bay, Hokkaido, Japan, photographed by Shinri Tomioka.



References

Altschul, S. F., Madden, T. L., Schäffer, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D. J. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 25: 3389–3402.

Boom, R., Sol, C. J., Salimans, M. M., Jansen, C. L., Wertheim-van Dillen, P. M., and Van der Noordaa, J. 1990. Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology 28: 495–503.

Lobo, J., Costa, P. M., Teixeira, M. A. L., Ferreira, M. S. G., Costa, M. H, and Costa, F. O. 2013. Enhanced primers for amplification of DNA barcodes from a broad range of marine metazoans. BMC Ecology 13:34. DOI: 10.1186/1472-6785-13-34.

Palumbi, S., Martin, A., Romano, S., McMillan, W. O., Stice, L., Grabowski, G. 1991. The Simple Fools Guide to PCR, Ver. 2. Department of Zoology and Kewalo Marine Laboratory, University of Hawaii, Honolulu, 45 pp.

Rousset, V., Pleijel, F., Rouse, G. W., Erséus, C., and Siddall, M. E. 2006. A molecular phylogeny of annelids. Cladistics 23: 41–63.

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., and Kumar, S. 2011. MEGA5: molecullar evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28: 2731–2739.

Appendix
A 484-bp partial sequence of the mitochondrion-encoded 16S rRNA gene from ICHU1130007, an unidentified polychaete in the family Nereididae.

CGCCTACTGAACATATAGTAGGTCCATCCTGCCCAGTGAGTATTTCAACGGCCGCGGTATCTTGACCGTGCAAAGGTAGCATAATCAATTGCCTTCTAATTAAAGGCTAGTATGAATGGACACACAAGAATAAATCTGTCTCGTTTAGAATAATTATAATCTGTACAATAGGTGAAAATTCCTATGTAGCAATAAAAGACAAGAAGACCCTATAGAGCTTTACCTATAATAGCTAACTACTAAAATATAGGATTAGTTGGGACAACTAGAAAACATTTATACCTTTTACTATATTTACACCTACCCTTTAATGTAAAAGAATACAGCTACCTTAGGGATAACAGGCTAATTTTGCTAGAGAGATCACATTGACAGCATAGATTGGCACCTCGATGTTGGCTTAGTGTAACTATTGAGCGCAGCCGCTCAATTAAGTTGGTTTGTTCAACCATTAAATCACTACGTGATCTGAGTTCAGACCGGA