A peanut-worm specimen was collected from among byssi of the bivalves Mytilus trossulus Gould, 1850 and Septifer virgatus (Wiegmann, 1837) in the intertidal zone of Oshoro Bay, Hokkaido, Japan, at about 43°12′N, 140°51′E, on 27 April 2015 by Yuta Mabuchi. The specimen was photographed and fixed in 99% EtOH by Shinri Tomioka, and later identified by Hiroshi Kajihara as Themiste hexadactyla (Satô, 1930) by references to Nishikawa (1992), Schulze et al. (2012), and Maiorova and Adrianov (2013). Total DNA was extracted from the posterior portion of the body using the silica method (Boom et al. 1990) with some modifications. Extracted DNA was dissolved in 30 µl of deionized water and has been preserved at –20°C. Remaining morphological voucher specimen has been deposited at the Hokkaido University Museum under the catalogue number ICHU2130167 (contact: Dr. Hiroshi Kajihara, kazi@mail.sci.hokudai.ac.jp).
PCR amplification was attempted with the primer pairs LoboF1 (5′-KBTCHACAAAYCAYAARGAYATHGG-3′) and LoboR1 (5′-TGTTTYTTYGGWCAYCCWGARGTTTA-3′) (Lobo et al. 2013) for the mitochondrial cytochrome c oxidase subunit I gene (COI) and 16S ar-L (5′-CGCCTGTTTATCAAAAACAT-3′) and br-H (5′-CCGGTCTGAACTCAGATCACGT-3′) (Palumbi et al. 1991) for the 16S rRNA gene. PCR products were visualized by electrophoresis in 1% agarose gel. Of the two gene markers that were attempted, only 16S rRNA gene was confirmed to be successfully amplified. The PCR was performed by a thermal cycler, 2720 Thermal Cycler (Applied Biosystems), in a 20-µl reaction volume containing 1 µl of template total DNA (approximately 10–100 ng) and 19 µl of premix made with 632-µl deionized water, 80-µl Ex Taq Buffer (TaKara Bio), 64-µl dNTP (each 25 mM), 8-µl each primer (each 10 µM), and 0.1-µl TaKara Ex Taq (5 U/µl,TaKara Bio). Thermal cycling condition comprised an initial denaturation at 95°C for 30 sec; 30 cycles of denaturation at 95°C for 30 sec, annealing at 45°C for 30 sec, and elongation at 72°C for 45°C and a final elongation at 72°C for 7 min.
The PCR products of the 16S rRNA gene were purified with the silica method (Boom et al. 1990). Both strands were sequenced with a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) following the manufacturer's protocol, using the same primer set as the initial PCR amplification. Sequencing was performed with ABI Prism 3730 DNA Analyzer (Applied Biosystems). Chromatogram and sequence data were operated with MEGA v5.2 software (Tamura et al. 2011).
Results
The mitochondrial 16S rRNA gene was partially determined for a 481-bp stretch from the peanut-worm specimen ICHU2130167, which was identified as Themiste hexadactyla (Satô, 1930) (see Appendix). A nucleotide BLAST search (Altschul et al. 1997) at the NCBI website (https://blast.ncbi.nlm.nih.gov/) resulted in that our sequence from Oshoro matched in 99% similarity (100% query coverage; E value = 0.0) with the following three sequences from the Russian Far East (Schulze et al. 2012): JQ904431 (Aleut Bay), JQ904447 (Vostok Bay), and JQ904449 (Vostok Bay).
Taxonomy
Phylum Annelida
Family Themistidae Cutler and Gibbs, 1985
Genus Themiste Gray, 1828
Themiste hexadactyla (Satô, 1930)
[Japanese name: mutsude-hoshimushi]
(Fig. 1)
Dendrostoma hexadactylum Satô, 1930: 28–33, pl. IV, figs 20–24, text-figs 13–15, from Mutsu Bay, Aomori Prefecture, northern Honshu, Japan.
Fig. 1. Themiste hexadactyla (Satô, 1930) (ICHU2130167) from Oshoro Bay, Hokkaido, Japan, photograph taken in life by Shinri Tomioka.
References
Altschul, S. F., Madden, T. L., Schäffer, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D. J. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 25: 3389–3402.
Boom, R., Sol, C. J., Salimans, M. M., Jansen, C. L., Wertheim-van Dillen, P. M., and Van der Noordaa, J. 1990. Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology 28: 495–503.
Lobo, J., Costa, P. M., Teixeira, M. A. L., Ferreira, M. S. G., Costa, M. H, and Costa, F. O. 2013. Enhanced primers for amplification of DNA barcodes from a broad range of marine metazoans. BMC Ecology 13:34. DOI: 10.1186/1472-6785-13-34.
Maiorova, A. S. and Adrianov, A. A. 2013. Peanut worms of the phylum Sipuncula from the Sea of Japan with a key to species. Deep Sea Research Part II: Topical Studies in Oceanology 86–87: 140–147.
Nishikawa, T. 1992. Sipuncula. Pp. 299–305. In: Nishimura, S. (Ed.) Guide to Seashore Animals of Japan with Color Pictures and Keys, Vol. I. Hoikusha, Osaka. [In Japanese]
Palumbi, S., Martin, A., Romano, S., McMillan, W. O., Stice, L., Grabowski, G. 1991. The Simple Fools Guide to PCR, Ver. 2. Department of Zoology and Kewalo Marine Laboratory, University of Hawaii, Honolulu, 45 pp.
Satô, H. 1930. Report of the biological survey of Mutsu Bay. 15. Sipunculoidea. Science Reports of the Tôhoku Imperial University, Fourth Series, Biology 5(1): 1–40, pls I–IV.
Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., and Kumar, S. 2011. MEGA5: molecullar evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28: 2731–2739.
AppendixA 481-bp partial sequence of the mitochondrial 16S rRNA gene, determined from ICHU2130167 identidied as Themiste hexadactyla collected in Oshoro Bay on the Sea of Japan coast of Hokkaido, northern Japan.
CAAAAAATCAAAATAGATGTCTGAAAAGAATAGGGTCTCCGCCCCCTCCTGGGTCAAAAAAGGCAGTATTTAAATTTCGATCTGTTAGTAATATTGTAATAGCTCCCGCTAATACAGGGAGAGCTAGAAGTAAAAGGATAACTGTAATAAAGGCTGCCCATACAAATAAAGGTACTCGTTCCCAAGAAAATATTCTAGGTCGTATATTTGTTACTGTAGAAATAAAATTTAATGCACCTAAAATTGATCTTACTCCGGCTAAATGAAGAGAGAAGATAGCTAAGTCTACTGATGCGCCTGCATGAGCTAGAGCACCAGATAAAGGAGGATAAACTGTTCAGCCAGTACCAACTCCTTTTTCTACGGCCCTAGATGCTAGTAGGAGACATAGAGCAGGGGGTAATAATCAAAAACTAAGATTATTTAAACGAGGAAAAGCTATATCTGGAGCTCCAATTATTAGTGGAATTAACCAGTTTCCAAATCCTCCAATTAGAACAGGTATTACTAAAAAGAAAATTATTAAAAATGCATGAGCTGTAACAATAACATTATAGAGCTGGTCTCTACCTAATAAAGATCCAGGCTGGCCAAGTTCCGCTCGAATAAGAAGTCTTATTGAAGTTCCCATGAGGCCTGATCAGAT