Report of Systematic Zoology Lab Practicum, Volume 6: e18; August, 2015


16S rRNA partial sequence of the nudibranch Rostanga orientalis (Mollusca: Opisthobranchia) from Oshoro Bay, Hokkaido, Japan


Nagi Matsushita and Hiroko Adachi

Division of Biology, Department of Biological Sciences, School of Science, Hokkaido University, Sapporo 060-0810, Japan


Material and Methods
A dorid nudibranch was collected from under stone in the intertidal zone of Oshoro Bay, Hokkaido, Japan, about 43°12′N, 140°51′E, on 25 May 2015 by Nagi Matsushita, photographed by Shinri Tomioka, and fixed in 99% EtOH. The specimen was identified by Hiroshi Kajihara based on the photographs as Rostanga orientalis Rudman and Avern, 1989, according to Hamatani (1994). Total DNA was extracted from the middle part of the body using the silica method (Boom et al. 1990) with some modifications. The extracted DNA was dissolved in 30 µl of deionized water and has been preserved at –20°C. Remaining morphological voucher specimen has been deposited at the Hokkaido University Museum under the catalogue number ICHU2130889 (contact: Dr. Hiroshi Kajihara, kazi@mail.sci.hokudai.ac.jp).
      PCR amplification was attempted with the primer pairs LoboF1 (5′-KBTCHACAAAYCAYAARGAYATHGG-3′) and LoboR1 (5′-TGTTTYTTYGGWCAYCCWGARGTTTA-3′) (Lobo et al. 2013) for the mitochondrial cytochrome c oxidase subunit I gene (COI) and 16S ar-L (5′-CGCCTGTTTATCAAAAACAT-3′) and br-H (5′-CCGGTCTGAACTCAGATCACGT-3′) (Palumbi et al. 1991) for the 16S rRNA gene . PCR products were visualized by electrophoresis in 1% agarose gel. Of the two gene markers that were attempted, only 16S rRNA gene was confirmed to be successfully amplified. The PCR was performed by a thermal cycler, 2720 Thermal Cycler (Applied Biosystems), in a 20-µl reaction volume containing 1 µl of template total DNA (approximately 10–100 ng) and 19 µl of premix made with 632-µl deionized water, 80-µl Ex Taq Buffer (TaKara Bio), 64-µl dNTP (each 25 mM), 8-µl each primer (each 10 µM), and 0.1-µl TaKara Ex Taq (5 U/µl,TaKara Bio). Thermal cycling condition comprised an initial denaturation at 95°C for 30 sec; 30 cycles of denaturation at 95°C for 30 sec, annealing at 45°C for 30 sec, and elongation at 72°C for 45°C and a final elongation at 72°C for 7 min.
      The PCR products of the 16S rRNA gene was purified with the silica method (Boom et al. 1990). Both strands were sequenced with a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) following the manufacturer's protocol, using the same primer set as the initial PCR amplification. Sequencing was performed with ABI Prism 3730 DNA Analyzer (Applied Biosystems). Chromatogram and sequence data were operated with MEGA v5.2 software (Tamura et al. 2011).


Results
A total of 440 bp of partial sequence of the mitochondrial 16S rRNA gene was determined from ICHU2130889, identified as Rostanga orientalis (see Appendix). A nucleotide BLAST search (Altschul et al. 1997) at the NCBI website (https://blast.ncbi.nlm.nih.gov/) resulted in that our sequence from Oshoro showed 95% similarity with AY345044 (E value = 0.0), a sequence from a dorid nudibranch identified as Rostanga pulchra MacFarland, 1905 collected in California, USA (Grande et al. 2004).


Taxonomy
Phylum Mollusca
Class Gastropoda
Subclass Heterobranchia
Infraclass Opisthobranchia
Order Nudibranchia
Infraorder Doridacea
Family Discodorididae
Genus Rostanga Bergh, 1879
Rostanba orientalis Rudman and Avern, 1989
[Japanese name: isoumiushi]
(Fig. 1)


Fig. 1. Rostanga orientalis Rudman and Avern, 1989 (ICHU2130889), dorsal view, taken in life.




References

Altschul, S. F., Madden, T. L., Schäffer, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D. J. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 25: 3389–3402.

Boom, R., Sol, C. J., Salimans, M. M., Jansen, C. L., Wertheim-van Dillen, P. M., and Van der Noordaa, J. 1990. Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology 28: 495–503.

Grande, C., Templado, J., Cervera, J. L., and Zardoya, R. 2004. Molecular phylogeny of Euthyneura (Mollusca: Gastropoda). Molecular Biology and Evolution 22: 303–313.

Hamatani, I. 1994. Umiushi-rui [Nudibranchs]. Pp. 155–176. In: Okutani, T. (Ed.) Umibeno Ikimono [Seashore Creatures]. Yama-Kei Publishers, Tokyo. [In Japanese]

Lobo, J., Costa, P. M., Teixeira, M. A. L., Ferreira, M. S. G., Costa, M. H, and Costa, F. O. 2013. Enhanced primers for amplification of DNA barcodes from a broad range of marine metazoans. BMC Ecology 13:34. DOI: 10.1186/1472-6785-13-34.

Palumbi, S., Martin, A., Romano, S., McMillan, W. O., Stice, L., Grabowski, G. 1991. The Simple Fools Guide to PCR, Ver. 2. Department of Zoology and Kewalo Marine Laboratory, University of Hawaii, Honolulu, 45 pp.

Rudman, W. B. and Avern, G. J. 1989. The genus Rostanga Bergh, 1879 (Nudibranchia: Dorididae) in the Indo-West Pacific. Zoological Journal of the Linnean Society 96: 281–338.

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., and Kumar, S. 2011. MEGA5: molecullar evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28: 2731–2739.




Appendix
A 440-bp partial sequence of the mitochondrial 16S rRNA gene from ICHU2130889, identidied as Rostanga orientalis .

AGCCTGAGGAAATTTAATCTCAGGGTTAAACCTGCCCAATGTTATTTCTATTAATGGCCGCGGTACTTTGACCGTGCTAAGGTAGGGCAATCAATTGGCTTTTAATTGAAGCCACGTATGAATGGAATCACGGGGTTTAGCTGTCTCTTAACTAGTCTATCGAAATTACTATTTAGGTGAAAAAGCCTAAAAAAAGAAAAAAGACGAGAAGACCCTTAGAGTTTTTCTAAGTAGAAATTATTTTTTAGAAAGTTTAGTTGGGGCAACATAGGAACAAATATTAACCTCCTGTAATTTATAAACCGATAATTATAAAGATGAATAAACTACCTTAGGGATAACAGCATAATTTTATAAATAAGTTTGTGACCTCGATGTTGGACTAGGAAACTAAAGGGCTAGCCGCCTTTTAGGAAAGTTCTGTTCGAACTATTATTCCT