Report of Systematic Zoology Lab Practicum, Volume 6: e20; August, 2015


Partial sequence of the histone H3 gene of cf. Paranthura japonica (Crustacea: Isopoda: Anthuroidea) from Oshoro Bay, Hokkaido, norhtern Japan


Hiroki Ono

Division of Biology, Department of Biological Sciences, School of Science, Hokkaido University, Sapporo 060-0810, Japan


Material and Methods
An anthurid isopod was collected among either holdfasts of brown alagae [Undaria pinnatifida (Harvey) Suringar and/or Saccharina longissima (Miyabe) Yotsukura et Druehl] or byssi of the bivalves Mytilus trossulus Gould, 1850 and/or Septifer virgatus (Wiegmann, 1837) in Oshoro Bay, Hokkaido, Japan, about 43°12′N, 140°51′E, on 1 June 2015 by Hiroki Ono, photographed and fixed in 99% EtOH by Shinri Tomioka; the specimen was tentatively identified by Hiroshi Kajihara as Paranthura japonica Richardson, 1909 with reference to Nunomura (1995).
      Total DNA was extracted from the anterior harf of the body using the silica method (Boom et al. 1990) with some modifications. Extracted DNA was dissolved in 30 µl of deionized water and has been preserved at –20°C. Remaining morphological voucher specimen has been deposited at the Hokkaido University Museum under the catalogue number ICHU2132065 (contact: Dr. Hiroshi Kajihara, kazi@mail.sci.hokudai.ac.jp).
      PCR amplification was attempted for four gene markers, using the primer pairs LoboF1 (5′-KBTCHACAAAYCAYAARGAYATHGG-3′) and LoboR1 (5′-TGTTTYTTYGGWCAYCCWGARGTTTA-3′) (Lobo et al. 2013) for the mitochondrial cytochrome c oxidase subunit I gene (COI), 16S ar-L (5′-CGCCTGTTTATCAAAAACAT-3′) and br-H (5′-CCGGTCTGAACTCAGATCACGT-3′) (Palumbi et al. 1991) for the mitochondrial 16S rRNA gene, H3aF (5′-ATGGCTCGTACCAAGCAGAC-3′) and aR (5′-ATATCCTTRGGCATRATRGTGAC-3′) (Colgan et al. 1998) for the nuclear histone H3 gene, and LSU5 (5′-ACCCGCTGAAYTTAAGCA-3′) and LSU3 (5′-TCCTGAGGGAAACTTCGG-3′) (Littlewood 1994) for the nuclear 28S rRNA gene. PCR products were visualized by electrophoresis in 1% agarose gel. Of the four markers tried, only H3 was successfully amplified. The PCR was performed by a thermal cycler, 2720 Thermal Cycler (Applied Biosystems), in a 20-µl reaction volume containing 1 µl of template total DNA (approximately 10–100 ng) and 19 µl of premix made with 632-µl deionized water, 80-µl Ex Taq Buffer (TaKara Bio), 64-µl dNTP (each 25 mM), 8-µl each primer (each 10 µM), and 0.1-µl TaKara Ex Taq (5 U/µl,TaKara Bio). Thermal cycling condition comprised an initial denaturation at 95°C for 30 sec; 30 cycles of denaturation at 95°C for 30 sec, annealing at 45°C for 30 sec, and elongation at 72°C for 45°C and a final elongation at 72°C for 7 min.
      The PCR products of the histone H3 gene was purified with the silica method (Boom et al. 1990). Both strands were sequenced with a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) following the manufacturer's protocol, using the same primer set as the initial PCR amplification. Sequencing was performed with ABI Prism 3730 DNA Analyzer (Applied Biosystems). Chromatogram and sequence data were operated with MEGA v5.2 software (Tamura et al. 2011).


Results
A total of 332 bp of the nuclear histone H3 gene was determined from ICHU2132065, identified as cf. Paranthura japonica (see Appendix). A nucleotide BLAST search (Altschul et al. 1997) at the NCBI website (https://blast.ncbi.nlm.nih.gov/) showed that the most similar GenBank entry to my sequence was KC428949 (84% similarity; 98% query coverage; E value = 2e–81), which is a H3 sequence determined from an idoteid isopod, Idotea sp., collected in Wood Hole, USA (Hurt et al. 2013); there was no H3 seuqnce of anthroid isopods deposited in GenBank as of writing.


Taxonomy
Phylum Arthropoda
Subphylum Crustacea
Class Malacostraca
Superorder Peracarida
Order Isopoda
Superfamily Anthuroidea
Family Paranthuridae Menzies and Glynn, 1968
Genus Paranthura Spence Bate and Westwood, 1866
Paranthura japonica Richardson, 1909
[Japanese name: yamato-umi-nanafushi]
(Figs 1, 2)


Fig. 1. cf. Paranthura japonica Richardson, 1909 (ICHU2132065), left lateral view, photographed by Shinri Tomioka.


Fig. 2. cf. Paranthura japonica Richardson, 1909 (ICHU2132065), right lateral view, photographed by Shinri Tomioka.



References

Altschul, S. F., Madden, T. L., Schäffer, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D. J. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 25: 3389–3402.

Colgan, D. J., McLauchlan, A., Wilson, G. D. F., Livingston, S. P., Edgecombe, G. D., Macaranas, J., Cassis, G., and Gray, M. R. 1998. Histone H3 and U2 snRNA DNA sequences and arthropod molecular evolution. Austrarian Journal of Zoology. 46(5): 419–437.

Hurt, C., Haddock, S. H. D., and Browne, W. E. 2013. Molecular phylogenetic evidence for the reorganization of the Hyperiid amphipods, a dverse group of pelagic crustaceans. Molecular Phylogenetics and Evolution. 67: 28–37.

Littlewood, D. T. J. 1994. Molecular phylogenetics of cupped oysters based on partial 28S rRNA gene sequences. Molecular Phylogenetics and Evolution. 3: 221–229.

Lobo, J., Costa, P. M., Teixeira, M. A. L., Ferreira, M. S. G., Costa, M. H, and Costa, F. O. 2013. Enhanced primers for amplification of DNA barcodes from a broad range of marine metazoans. BMC Ecology 13:34. DOI: 10.1186/1472-6785-13-34.

Nunomura, N. 1995. Isopoda. Pp. 205–233. In: Nunomura, S. (Ed.) Guide to Seashore Animals of Japan with Color Pictures and Keys, Vol. II. Hoikusha, Osaka. [In Japanese]

Palumbi, S., Martin, A., Romano, S., McMillan, W. O., Stice, L., Grabowski, G. 1991. The Simple Fools Guide to PCR, Ver. 2. Department of Zoology and Kewalo Marine Laboratory, University of Hawaii, Honolulu, 45 pp.

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., and Kumar, S. 2011. MEGA5: molecullar evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28: 2731–2739.

Appendix
A 332-bp partial sequence of the nuclear histone H3 gene from ICHU2132065, identified as cf. Paranthura japonica Richardson, 1909.

TCGCACGTAAATCTACCGGAGGTAAAGCTCCCAGAAAGCAGCTCGCCACCAAAGCTGCCAGGAAATCAGCTCCTGCCACTGGTGGCGTTAAGAAGCCCCACAGATACCGCCCTGGTACTGTAGCTCTTCGTGAAATCAGAAGATACCAGAAGAGCACCGAGCTTCTCATCAGAAAACTTCCCTTCCAGAGGCTGGTCAGAGAAATCGCTCAAGATTTCAAAACCGACCTCAGGTTCCAGTCTTCCGCCGTCATGGCTCTTCAGGAAGCTTCCGAAGCCTATCTCGTAGGACTCTTCGAGGATACCAACTTGTGCGCTATTCACGCCAAGAGA